Linolenic Fatty Acid Dehydrogenase Gene and Its Application

A technology of fatty acid dehydrogenase and flax, applied in the field of genetic engineering, can solve problems such as hindering gene sequence optimization and hindering secondary structure

Active Publication Date: 2016-04-06
INNER MONGOLIA UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, plant-derived genes are usually difficult to express and function in mammals, so how to optimize the gene sequence so that it can function in mammals is a technical problem to be solved in this field. In the process of codon optimization There are many challenges in this process: firstly, how to obtain the gene sequence that can be expressed; secondly, considering the stability of the foreign gene mRNA and the influence of the secondary structure of the mRNA on the translation efficiency, it is necessary to avoid the secondary structure of the special mRNA that hinders the expression during optimization. formation of class structure
The above challenges hinder the optimization of gene sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Linolenic Fatty Acid Dehydrogenase Gene and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0010] 1. Synthesis of FAD3 Gene Humanized Fragment

[0011] CCGGAATTCttcaaaactgtggctctgcaggaccaaact ATGTCCCTCCCCAACTCCATGTCCCCCAC CACCAACGGCAACGGTGTGGCTATGAATGGGGCCAAGAAGCAGCTGGATTTTGACCCCT CCGCTGCCCCCCCCTTCAAGATTGCCGACATCCGCGCTGCCATCCCCCCCACTGCTGGG TGAAGAACCCCTGGCGCTCCCTGTCCTACGTCCTGAGAGACCTGCTGGTCATCCTGTCCT TCGCCGTGGCGGCTGCCAAGCTGGACTCCTGGACTTTCTGGCCCCTGTACTGGGTGGCT CAGGGCACCATGTTCTGGGCCGTCTTTGTGCTGGGCCACGACTGTGGCCATGGCTCCTTC TCCGACATCTGGCTGCTGAACAACGTGATGGGCCACATCCTGCACTCCTCCATCCTGGTG CCCTACCATGGCTGGAGAATCTCCCACAAGACCCACCACCAGAACCACGGCAATGTGGA GAA-GATGA-TCCTGGGTGCCTCTGCCCGAGAAGGTGTACAAGTCCCTGGACACCTCCA CTAA-TTCATGCGCTTCACCATCCCTCTCCCCATGTTTGCTTATCCTATCTACCTGTGGAC CCGTTCCCCCGGCAAGAAGGGCTCCCACTTCAACCCCTACTCCGACCTGTTCGCCCCCA ACGAGCGCGCAGCGGTCCTGATCTCCACCCTGTGCTGGACCGCCATGGCCCTGCTCCTG TGCTACTCCTCCTTCATCTACGGCTTCGCTCCCGTCCTGAAGATCTACGGCGTGCCTTATC TGATCTTCGTGGCCTGGCTGGGACATGGTGACCTACCTGCACCACCACGGCTACGAGCAG AA-CTGCCCTGGTACAGAGGCAAAAGAGTG-TCCTACCTGCGC-CG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a flax fatty acid dehydrogenase gene (FAD3) which can be expressed in mammals as well as an application of the gene. The gene includes a nucleotide sequence represented in SEQ ID NO.1 or a complementary nucleotide sequence thereof. The sequence of the flax fatty acid dehydrogenase gene can promote transformation of n-6 fatty acid in cells to n-3 fatty acid.

Description

technical field [0001] The invention belongs to the genetic engineering technology in the field of biotechnology, and in particular relates to a gene codon of flax fatty acid dehydrogenase and its application. Background technique [0002] Fatty acid refers to a long aliphatic hydrocarbon chain containing a carboxyl group at one end. Polyunsaturated fatty acids (PUFAs) contain more than one (C=C) and a carbon skeleton greater than 18 carbon atoms. They are fatty acids that make up the human body. Essential substances, very important to human health. According to the position of the double bond, polyunsaturated fatty acids are divided into: ω-6PUFAs and ω-3PUFAs. ω-6PUFAs include γ-linolenic acid (γ-LA), arachidonic acid (AA), linoleic acid (18:2n-6) and so on. ω-3PUFAs include α-linolenic acid (α-LA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA) and the like. The ω-3 desaturase gene can convert ω-6 PUAFs into ω-3 PUAFs, which plays ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/63C12N15/85
Inventor 李光鹏左永春魏著英扈廷茂
Owner INNER MONGOLIA UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products