Supercharge Your Innovation With Domain-Expert AI Agents!

Fusion protein used for preparing human cytokine induced killer cells

A fusion protein and cell-killing technology, which is applied in the fields of biotechnology and medicine, can solve problems such as insufficient effective treatment, and achieve the effect of improving tumor-killing activity and enhancing tumor-killing activity

Inactive Publication Date: 2014-01-01
SHENZHEN YOUNGCELL BIO TECH
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The proportion of CD3 / CD56 double-positive cells in CIK cells obtained by the existing technology only accounts for 10-30% of the total number of cells, which cannot fully meet the needs of effective treatment. Therefore, it is necessary to find new culture methods to increase the number of CD3 / CD56 double-positive cells. proportion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein used for preparing human cytokine induced killer cells
  • Fusion protein used for preparing human cytokine induced killer cells
  • Fusion protein used for preparing human cytokine induced killer cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Obtaining of fusion protein

[0048] 1. Obtaining the target gene

[0049] According to the human ICAM-1 and FN gene sequences, two pairs of primers were designed: forward primer P1 and reverse primer P2 of human ICAM-1; forward primer P3 and reverse primer P4 of human FN. And the target gene sequence was obtained by two-step PCR. The primer sequences are as follows:

[0050] Pl: 5'-CATCATCATCATCATCAT CATATG CAGACATCTGTGTCCCC-3' (SEQ ID NO: 3)

[0051]

[0052] GGTGTTCT-3' (SEQ ID NO: 4)

[0053]

[0054] GATTCAC-3' (SEQ ID NO: 5)

[0055] P4: 5'-AGACTGCAGGTCGAC AAGCTT TTATGTGGAAGGAACATCCAA

[0056] GAT-3' (SEQ ID NO: 6)

[0057] The 5' end of the P1 primer introduces an NdeI restriction site (underlined and italicized part), and the 5' end of the P2 primer introduces the complementary sequence (boxed part) of the flexible peptide GGGGSGGGGS (SEQ ID NO: 1) cDNA to contain human ICAM-1 The plasmid with cDNA sequence (purchased from Origene) was u...

Embodiment 2

[0108] Example 2 Preparation of CIK cells

[0109] 1. Preparation of CIK cells

[0110] (1) 75cm 2 Handling of culture bottles

[0111] The coating solution was prepared with DPBS, containing 5 μg / ml of human CD3 monoclonal antibody and 10 μg / ml of the ICAM-FN fusion protein obtained in Example 1. Take 10ml of coating solution, add to 75cm 2 Store in a culture bottle overnight at 4oC in the dark.

[0112] (2) Preparation of mononuclear cells

[0113] Obtain 100ml of fresh peripheral blood, centrifuge (700g, 20min), and divide into two layers after centrifugation, the upper layer is plasma, and the lower layer is blood cells. After the upper layer of plasma was processed, it was stored at 4oC for future use. The blood cells in the lower layer were diluted to 100ml with DPBS, and the mononuclear cells were separated with lymphocyte separation medium with a specific gravity of 1.077, washed twice with DPBS, observed and counted under a microscope, and finally mixed with 5% ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of human cytokine-induced killer cells, comprising the following steps: coating a cell culture flask with a coating buffer containing effective amount of fusion protein and human CD3 monoclonal antibody before culturing precursor cells of human CIK cells, and adding the human CD3 monoclonal antibody in the whole process of inducing and culturing the human CIK cells, wherein the fusion protein is human intercellular adhesion molecule-1 functional domain and human fibronectin functional domain fusion protein, and the concentration of the human CD3 monoclonal antibody in the cell culture solution is lower than the concentration of the human CD3 monoclonal antibody in the coating buffer. According to the invention, ex-vivo expansion efficiency of peripheral blood mononuclear cells and the proportion of CD3 / CD56 double positive cells in the CIK cells are significantly raised, the cytotoxicity activity of the CIK cells is enhanced, thus the effect of cellular immunity treatment is raised.

Description

technical field [0001] The invention relates to the fields of biotechnology and medicine. Specifically, the present invention relates to a fusion protein for preparing human cytokine-induced killer cells and a preparation method of the human cytokine-induced killer cells. Background technique [0002] The incidence of tumors has been on the rise since the records of cancer, especially in the past two or three decades, the incidence of tumors has been increasing at a rate of 3%-5% per year. With the increasing incidence of tumors, the treatment options for tumors are also constantly developing. Immunotherapy is one of the important treatment methods. It is of great significance to improve the survival rate of patients and relapse. Among immunotherapy methods, cell biology therapy has already made its debut and has become an important development direction of tumor therapy. Following lymphokine-induced killer cells (LAK), tumor-infiltrating lymphocytes (TIL) and CD3 monoclo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N5/0783
Inventor 郑意端
Owner SHENZHEN YOUNGCELL BIO TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More