Coenzyme-Q10-production engineered bacteria construction method, engineered bacteria, and application thereof
A construction method and technology of engineering bacteria, applied in the field of production of coenzyme Q10 engineering bacteria, achieving high application value and industrial practicability, low requirements for instruments and equipment, and increasing production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1. Construction of recombinant plasmids
[0038] 1. Design primers
[0039] Primer sequences were designed using Primer5 primer design software. Clone gene UbiG,
[0040] Upstream primer: CGGGATCCGCAATGGAATCGTCCAGCACC,
[0041] Downstream primer: CCCAAGCTTTCTGAGACGGGACCGGAAG,
[0042] The upstream primer added restriction site BamHI, and the downstream primer added restriction site HindIII.
[0043] 2. Extract the genome of Rhodobacter sphaeroides (all reagents used are from Biospin Bacterial Genomic DNA Extraction Kit)
[0044] 1) Aspirate 0.5-4mL bacteria (up to 5×109 bacteria), centrifuge at 13500rpm for 1 minute, and aspirate the supernatant as much as possible.
[0045] 2) Add 100 μL EL Buffer and pipette evenly with a tip.
[0046] 3) Incubate at 37°C for 40 minutes.
[0047] 4) Add 100μL RS Buffer, then add 10μL PK Solution, and mix well.
[0048] 5) Incubate at 56°C for 15 minutes, then remove.
[0049] 6) Add 200μL GA Buffer and mix well.
[0050]7) C...
Embodiment 2
[0105] Fermentation culture
[0106] First-class seeds: Pick a single clone of the NHU-ZUB strain and inoculate it in a 50-mL shake flask containing 10 mL of seed medium, at a rotation speed of 200 rpm, and incubate at 30°C for 23 hours.
[0107] Secondary seeds: transfer 1% of the first-grade seeds to a 50mL shake flask containing 20mL of seed medium, and cultivate them at 30°C and 200rpm for 23 hours to obtain the second-grade seeds.
[0108] Fermentation culture: inoculate 1% secondary seeds into 500mL containing 100mL fermentation medium, and culture at 30°C and 200rpm for 120h. Collect the bacterial liquid and extract coenzyme Q10.
experiment example
[0109] Experimental example: HPLC detection and comparison of Q10 yield comparison before and after strain transformation, see Table 1:
[0110] Table 1 Comparison of Q10 yield before and after strain transformation
[0111] strain type Coenzyme Q10 production original strain 2500mg / L NHU-ZUB strain 2950mg / L
[0112] From the above table, the coenzyme Q10 output of the transformed strain increased from 2500mg / L to 2950mg / L.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 