Unlock instant, AI-driven research and patent intelligence for your innovation.

Ribonucleic acid (RNA) interference gene of plutella xylostella juvenile hormone esterase gene and application thereof

A juvenile hormone esterase, RNA interference technology, applied in the direction of DNA / RNA fragments, applications, recombinant DNA technology, etc.

Active Publication Date: 2014-06-11
INST OF PLANT PROTECTION FAAS
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the RNAi research on the juvenile hormone esterase of Plutella xylostella has not been reported yet, and Li Xiaojing (2012) made the juvenile hormone cyclohydrolase gene RNAi experiments were performed after cloning, and no significant interference effect was observed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ribonucleic acid (RNA) interference gene of plutella xylostella juvenile hormone esterase gene and application thereof
  • Ribonucleic acid (RNA) interference gene of plutella xylostella juvenile hormone esterase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1 The silencing effect of dsRNA on the substrate binding site of diamondback moth juvenile hormone esterase

[0017] Step 1, dsRNA design and synthesis

[0018] According to the Plutella xylostella cDNA library sequence information provided by the Applied Ecology Institute of Fujian Agriculture and Forestry University, the sequences and deduced functional region sequences were searched and compared on BLAST, and specific amplification primers were designed using the software Primer Premier 5.0 (5′-end plus T7promoter sequence), which is used to amplify the gene of the functional region of the substrate binding site of Plutella xylostella xylostella juvenile hormone esterase. According to the gene sequencing results, dsRNA primers were designed using the software Primer Premier 5.0, and the primer sequences are as follows:

[0019] Sense strand 5'-TTCCATTTGCCCTCAGTCC

[0020] Antisense strand 3'-GAAGAAGAGGTTGCCAATCC

[0021] Step 2. Effects of feeding dsRNA on...

Embodiment 2

[0034] Embodiment 2 dsRNA is to the silencing effect of diamondback moth juvenile hormone esterase catalytic site

[0035] Step 1, dsRNA design and synthesis

[0036] According to the Plutella xylostella cDNA library sequence information provided by the Applied Ecology Institute of Fujian Agriculture and Forestry University, the sequences and deduced functional region sequences were searched and compared on BLAST, and specific amplification primers were designed using the software Primer Premier 5.0 (5′-end plus T7promoter sequence), used to amplify the catalytic site functional region gene of Plutella xylostella xylostella juvenile hormone esterase. According to the gene sequencing results, dsRNA primers were designed using the software Primer Premier 5.0, and the primer sequences are as follows:

[0037] Sense strand 5'-CTAGGGATGTCGTGGTCG

[0038] Antisense strand 3'-CGGTCAGAGTGCCGG

[0039]Step 2. Effect of feeding dsRNA on mortality and juvenile hormone esterase activit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a ribonucleic acid (RNA) interference gene of a plutella xylostella juvenile hormone esterase gene and application thereof. The first RNA interference sequence is a double-chain RNA molecule; the RNA molecule sequence is as follows: a positive-sense strand: SEQ ID NO:1TTCCATTTGCCCTCAGTCC, an antisense strand: SEQ ID NO:2GAAGAAGAGGTTGCCAATCC, the RNA interference gene has a silence effect on a DNA segment in the encoded juvenile hormone esterase substrate binding site area, the second RNA interference sequence is a double-chain RNA molecule; the RNA molecule is as follows: a positive-sense strand: SEQ ID NO:3CTAGGGATGTCGTGGTCG, an antisense strand: SEQ ID NO:4CGGTCAGAGTGCCGG; the RNA interference gene has a silence effect on the DNA in the encoded juvenile hormone esterase catalytic site area. By adopting the interfering RNA sequence disclosed by the invention, the death rate of the plutella xylostella larvae is effectively improved, and the growth rate of the larva is reduced.

Description

technical field [0001] The invention belongs to the field of agricultural insect pest control, and in particular relates to the RNA interference sequence and application of insect juvenile hormone esterase gene. Background technique [0002] Plutella xylostella belongs to Lepidoptera (Lepidoptera) Plutellidae (Plutellidae), scientific name is Plutella xylostella (Linnaeus), widely distributed all over the world, mainly damages Brassicaceae vegetables, due to the strong annual fecundity of diamondback moth, many generations, Because of its strong ecological adaptability and no diapause phenomenon in various insect states, it has become one of the most serious pests to cruciferous vegetables in the world today. Due to the irrational use of chemical insecticides, Plutella xylostella has developed resistance to all insecticides used for control. Exploring new control methods is of great significance for reducing pesticide pollution and improving vegetable yield and quality. [...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01N57/16A01P7/04
Inventor 魏辉顾晓军李新慧田厚军陈艺欣田素芬郑丽祯常虹
Owner INST OF PLANT PROTECTION FAAS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More