A kind of tobacco cadmium transport gene nthma4 and its cloning method and application
A gene transfer and gene transfer technology, applied in the field of tobacco cadmium transfer gene NtHMA4 and its cloning, can solve the problems of slow growth, decreased yield, and harm to tobacco growth and development
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1—— NtHMA4 gene cloning
[0051] Use the homologous gene Arabidopsis At HMA4 sequence to search the NCBI tobacco EST database to obtain the EST sequence of tobacco NtHMA4. ) to obtain a gene sequence (Ntom0672570); using this sequence as the core sequence to obtain the full length of the gene through RACE, the specific steps are: design RACE primers using the tobacco genome database (industry internal database) gene Ntom0672570 as the core sequence, and 3′RACE gene-specific The primer was AGAAACTGCTCATTGTGACAGCACA, and the 5'RACE gene-specific primer was CAACTGCAACAGCTGCAAGTGCTA. The cloned gene end RACE kit was Clontech SmartRACE cDNA Amplification Kit, and the reaction was carried out according to the kit instructions. A fragment of about 600bp was amplified at the 3' end, and a fragment of about 500bp was amplified at the 5' end. Sequencing was carried out after recovery, and the full-length cDNA of NtHMA4 was obtained by splicing with the core sequenc...
Embodiment 2
[0060] Embodiment 2——Plant Transformation Vector Construction
[0061] (1) Overexpression vector construction. According to the pBI121 vector sequence restriction site, use Primer Premier5.0 software to design the construction NtHMA4 The sequence of the primer pair for gene overexpression is as follows:
[0062] Forward primer: 5′-GGGT GGATCC CTTCCTTAGAGTAGAGTGTAGA-3′;
[0063] Reverse primer: 5′-TAAT GAGCTC CTACTCTATGACAATTTCTGATAA-3'.
[0064] Restriction sites are underlined.
[0065] by NtHMA4 Gene-positive clone DNA was used as template for PCR amplification. The amplification procedure of the PCR amplification system is the same as in Example 1. Double digestion system: the total reaction volume is 40 μL, including 10 μL of PCR purified product, 4 μL of 10×NEB Buffer1.1, 2 μL of BamHI and SacI, and 22 μL of sterilized double distilled water. Purify after digestion at 37°C overnight. Double digestion system of pBI121 vector: The total reaction volume is 40 μ...
Embodiment 3
[0075] Example 3 - Genetic Transformation of Tobacco
[0076] (1) Expression vector transformed into Agrobacterium
[0077] The recombinant vectors pBI121-NtHMA4 and pBI121-pQLi-NtHMA4 were transferred into Agrobacterium army GV3101.
[0078] Take out 3 tubes of Agrobacterium competent cells from the -80°C refrigerator, dissolve them on ice, and add the recombinant expression vectors pBI121-NtHMA4, pBI121-pQLi-NtHMA4 and pBI121 empty vector respectively.
[0079] Put the above mixture into liquid nitrogen for quick freezing for 1 minute, then transfer to a 37°C water bath for 5 minutes.
[0080] Add 1mL LB medium to the phase mixture, and incubate at 28°C and 220rpm for 3-4 hours.
[0081] The culture was spread on LB solid medium containing kanamycin (50mg / L) and rifampin (25mg / L), and cultured upside down at 28°C for 2-3 days. Clones containing the vector of interest were seen.
[0082] (2) Tobacco Transformation
[0083] Pick the Agrobacterium containing the target ve...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More