Detection method of rhodobacter sphaeroides phage in coenzyme Q10 production

A technology for the detection of Rhodobacter sphaeroides and a detection method, which is applied in the field of rapid detection of phages of Rhodobacter sphaeroides, which can solve problems such as lack of guidance for production, and achieve the effects of avoiding phage contamination events, simple methods, fast and accurate phage detection

Active Publication Date: 2015-11-25
SHENZHOU BIOLOGY & TECH CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When the test results come out, this batch of fermentation products has been involved in the next stage of scale-up production, which does not have the meaning of guiding production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of rhodobacter sphaeroides phage in coenzyme Q10 production
  • Detection method of rhodobacter sphaeroides phage in coenzyme Q10 production
  • Detection method of rhodobacter sphaeroides phage in coenzyme Q10 production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Artificially synthesize the target fragment according to SEQIDNo.1;

[0062] The target fragment is amplified by PCR with primers PF and PR, and the target fragment is recovered after amplification, wherein,

[0063] PF: TTTCGTCGTATCCGTCTCGGT;

[0064] PR: GATGTCTACCTCTTGATATAC;

[0065] Recovered target fragments, connect the recovered target fragments to the T vector, transform into E.coliDH5α competent cells, pick positive clones for enrichment culture, and extract plasmids after amplification. cut linearization, and the starting template was obtained after purification;

[0066] Dilute the starting template, starting templates with different copy numbers, the range is: 1.0×10 2 Copy - 1.0×10 6 Copy and divide equally by 10 times;

[0067] Using PremixExTaq from TaKaRa TM II Quantitative PCR kit recommended steps for PCR, specifically:

[0068] The PCR reaction system is 20 μl: Taq enzyme solution 10 μl, PF1 and PR1 primers 0.8 μl (10 pmol / μl), probe1 probe 0....

Embodiment 2

[0075] Artificially synthesize the target fragment according to SEQIDNo.1;

[0076] The target fragment is amplified by PCR with primers PF and PR, and the target fragment is recovered after amplification, wherein,

[0077] PF: TTTCGTCGTATCCGTCTCGGT;

[0078] PR: GATGTCTACCTCTTGATATAC;

[0079] Recovered target fragments, connect the recovered target fragments to the T vector, transform into E.coliDH5α competent cells, pick positive clones for enrichment culture, and extract plasmids after amplification. cut linearization, and the starting template was obtained after purification;

[0080] Dilute the starting template, starting templates with different copy numbers, the range is: 1.0×10 2 Copy - 1.0×10 6 Copy and divide equally by 10 times;

[0081] Using PremixExTaq from TaKaRa TM II Quantitative PCR kit recommended steps for PCR, specifically:

[0082] The PCR reaction system is 20 μl: Taq enzyme solution 10 μl, PF1 and PR1 primers 0.8 μl (10 pmol / μl), probe1 probe 0....

Embodiment 3

[0089] Artificially synthesize the target fragment according to SEQIDNo.1;

[0090] The target fragment is amplified by PCR with primers PF and PR, and the target fragment is recovered after amplification, wherein,

[0091] PF: TTTCGTCGTATCCGTCTCGGT;

[0092] PR: GATGTCTACCTCTTGATATAC;

[0093] Recovered target fragments, connect the recovered target fragments to the T vector, transform into E.coliDH5α competent cells, pick positive clones for enrichment culture, and extract plasmids after amplification. cut linearization, and the starting template was obtained after purification;

[0094] Dilute the starting template, starting templates with different copy numbers, the range is: 1.0×10 2 Copy - 1.0×10 6 Copy and divide equally by 10 times;

[0095] Using PremixExTaq from TaKaRa TM II Quantitative PCR kit recommended steps for PCR, specifically:

[0096] The PCR reaction system is 20 μl: Taq enzyme solution 10 μl, PF2 and PR2 primers 0.8 μl (10 pmol / μl), probe2 probe 0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of detection of a rhodobacter sphaeroides phage, and in particular relates to a rapid detection method of a rhodobacter sphaeroides phage in coenzyme Q10 production, wherein the detection method is achieved by selecting any one pair of primers in three pairs of specific primers, and conducting fluorescence quantitative PCR (polymerase chain reaction) detection on a probe corresponding to each pair of primers. The detection method, which selects specific primers and probes to determine the contamination condition of the coenzyme Q10 in accordance with the status of contaminated rhodobacter sphaeroides in coenzyme Q10 fermentation production, is rapid in detection and high in sensitivity, and the detection method is achieved by directly collecting a fermentation product from fermentation production in any stage and any scale and extracting genome DNA, and conducting fluorescence quantitative PCR detection; therefore, the method is simple, and is capable of rapidly and accurately detecting the phage within about two hours in the whole detection process; in the case of phage contamination, the method can completely avoid an event of phage contamination in a later stage of expanded production by immediately stopping the expanded production of the fermentation product of the current time, so as to reduce unnecessary loss.

Description

technical field [0001] The invention relates to the field of detection of Rhodobacter phage, in particular to a rapid detection method of Rhodobacter phage in the production of coenzyme Q10. Background technique [0002] Coenzyme Q10 is an antioxidant widely used in cardiovascular drugs, health products and cosmetics. At present, the global coenzyme Q10 is mainly produced in China, most of which use a series of fermentation equipment of different scales to gradually scale up the cultivation of Rhodobacter sphaeroides, and then extract the product from the fermentation product. Like the bacterial fermentation production of other products, if phage contamination occurs during the bacterial fermentation process, it will lead to a decrease in yield and product quality or even stop production, which will bring huge losses to the manufacturer. Therefore, avoiding and controlling phage contamination during the production process has always been a serious and difficult problem in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/70C12Q1/68
Inventor李可俊徐侃彦
OwnerSHENZHOU BIOLOGY & TECH CO LTD