Pinellia ternate trypsin inhibitor and its use in pest resistance

A technology of trypsin inhibition and pinellia, applied in the fields of biochemistry and molecular biology, can solve the problem of not separating protease inhibitors, and achieve the effects of not easy to degrade, high insect resistance activity, and long half-life

Inactive Publication Date: 2015-12-16
BAODING UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Different protease inhibitors have various functions in animals and plants. At present, there is no report on isolating protease inhibitors from Pinellia and studying their specific functions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pinellia ternate trypsin inhibitor and its use in pest resistance
  • Pinellia ternate trypsin inhibitor and its use in pest resistance
  • Pinellia ternate trypsin inhibitor and its use in pest resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Design degenerate primers based on the sequence of the conserved region of the trypsin inhibitor gene of Araceae Alocasia genus:

[0025] Fw: ATGGAGTTTATCCTGCTCCTTGTGTC (SEQ ID NO5)

[0026] Rv: CAGCCAGCCCTTCCTTCACCTTCAC (SEQ ID NO 6)

[0027] Using the homologous cloning technology, the cDNA obtained by reverse transcription of the extracted Pinellia trifoliate RNA was used as a template, and a gene fragment of about 640 bp was obtained by PCR amplification, and then the full-length cDNA of the gene was cloned by 3' and 5' RACE technology Sequence, sequence analysis shows: this gene cDNA full-length is 1046bp (SEQIDNO7), and open reading frame is 651bp, the precursor protein of coding 217 amino acids (such as figure 1 shown). The pinellia ternata inhibitor gene was named PtTI (Pinellia ternata Inhibitor, PtTI).

[0028] 1. Reverse transcription to generate cDNA first strand

[0029] (1) Add the following reagents to a 0.2mLeppendorf tube: 2μg total RNA, 500μg / mL an...

Embodiment 2

[0110] Using the p2300-35S-PtTI plant expression vector as a template, the mutants were obtained by overlapping extension PCR, and the mutation sites were the 56th and 57th amino acid residues PP were mutated to AA. The plant expression vector p2300-35S-PtTI2 was reconstructed, and transformed into tobacco by Agrobacterium-mediated method, and the transgenic tobacco plants with PtTI2 gene driven by 35S promoter were obtained.

Embodiment 3

[0111] Embodiment 3 Anti-aphid (Hemiptera) test

[0112] Plant PtTI gene-transferred tobacco and wild-type tobacco. Tobacco grows to 60 days. When the seedling period is about to end, take tobacco plants with the same growth size and the same number of leaves. 30 PtTI-transferred tobacco plants and 30 wild-type tobacco plants 100 mature wingless aphids were connected to each tobacco plant, and after 30 hours, the aphid inhibition rate was counted: aphid inhibition rate%=(100-remaining aphids on the leaves) / 100.

[0113] Experimental results: the aphid suppression rate of PtTI gene-transferred tobacco was 68%, and that of wild-type tobacco was 1%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pinellia ternate trypsin inhibitor and its use in pest resistance. The pinellia ternate trypsin inhibitor belongs to the technical field of biochemistry and molecular biology. The pinellia ternate trypsin inhibitor has an amino acid sequence shown in the formula of SEQ ID NO1 in the sequence table. The invention also discloses an active mutant of the pinellia ternate trypsin inhibitor. The pinellia ternate trypsin inhibitor has obvious effects of killing lepidopteron and hemipterous pests.

Description

technical field [0001] The invention belongs to the technical field of biochemistry and molecular biology, and in particular relates to a pinellia trypsin inhibitor and its application in insect resistance. Background technique [0002] Crop pests are one of the important factors that cause agricultural production reduction. According to the statistics of the Food and Agriculture Organization of the United Nations, the world's annual grain production is reduced by 20% to 30% due to plant diseases and insect pests. up to 450 million US dollars. Traditional pesticides are mainly some natural or synthetic chemicals. Although they can kill pests and protect crops in the short term, long-term use will cause toxicity to accumulate in plants, endangering the health of humans and other animals. It can also cause pests to develop resistance to insecticides, thereby reducing their efficacy. Therefore, many countries in the world have banned the use of chemical insecticides on crops, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/81C12N15/82A01H5/00
CPCC07K14/8117C12N15/8205C12N15/8286
Inventor靳茜周悦郝征贾晓梅贾春凤
OwnerBAODING UNIV