Neuropeptide snpf and its receptor gene and its application in Bactrocera dorsalis specific control agent

The technology of fruit fly and neuropeptide, which is applied in the field of genetic engineering, can solve the problems of aggravating the outbreak of agricultural pests, low specificity of pesticides, and threatening natural enemies of pests, etc., and achieves the effect of good application prospects.

Inactive Publication Date: 2019-04-09
SOUTHWEST UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, Bactrocera dorsalis has developed severe resistance to pesticides such as organophosphorus insecticides, pyrethroids, and avermectins on the market; pesticide residues seriously pollute the environment and cause hidden dangers to food safety; the specificity of pesticides Low toxicity, a threat to the natural enemies of pests, and the risk of exacerbating the outbreak of agricultural pests

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neuropeptide snpf and its receptor gene and its application in Bactrocera dorsalis specific control agent
  • Neuropeptide snpf and its receptor gene and its application in Bactrocera dorsalis specific control agent
  • Neuropeptide snpf and its receptor gene and its application in Bactrocera dorsalis specific control agent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Obtaining the open reading frame sequence of Bacteralis dorsalis neuropeptide sNPF and its receptor

[0041] 1. Primer design and amplification of the open reading frame sequence of Bacteralis dorsalis neuropeptide sNPF and its receptor

[0042] Based on genome and transcriptome data, using bioinformatics methods, after repeated analysis and comparison of Drosophila sNPF (Genbank No.AY626808) and its sNPFR (Genbank No.NP524176), the neuropeptide sNPF and its receptor of Bacteralis dorsalis were designed (sNPFR) nested PCR specific primers, the sequence is as follows:

[0043]

[0044] The total RNA of B. dorsalis was extracted with an RNA extraction kit, and reverse transcribed into cDNA with a reverse transcription kit.

[0045] Amplify Bacteralis dorsalis neuropeptide sNPF sequence: 50ul reaction system contains 24μL deionized water, 20μL 2×PrimeSTAR Max Premix, primers sNPF-1-F (as shown in SEQ ID NO: 1 in the sequence listing), sNPF- 1-R (shown as SE...

Embodiment 2

[0058] Example 2. Determination of the binding ability of Bacteralis dorsalis neuropeptide sNPF to its receptor based on intracellular calcium ion flow detection method

[0059] 1. Construction of Bacteralis dorsalis sNPFR CHO (Chinese hamster ovary cell) cell expression plasmid

[0060] The Bacteralis dorsalis neuropeptide sNPFR plasmid and pcDNA3.1 (+) plasmid connected on the T carrier recovered in Example 1 were connected (T4 DNA ligase) after NotI single enzyme digestion respectively, and after connection, refer to The transformation method in Example 1 was transformed, and after the positive identification of the bacterial liquid was correct (PCR detection was performed with the universal primer T7 / BGH, T7: TAATACGACTCACTATAGGG, BGH: TAGAAGGCACAGTCGAGG), the plasmid was extracted with a plasmid extraction kit, and the sNPFGPCR was obtained. Fragment of the pcDNA3.1(+) plasmid.

[0061] Co-transfection:

[0062] 1) Prepare 1.5mL serum-free medium DMEM / F-12medium in EP t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of neuropeptide sNPF (short neuropeptide F) and a receptor gene thereof in a bactrocera dorsalis specificity control agent. A bactrocera dorsalis neuropeptide sNPF gene shown as SEQ ID NO: 9 is provided, and encoded protein thereof is shown as SEQ ID NO: 10; nucleotide sequences of mature peptides of the bactrocera dorsalis neuropeptide sNPF shown as SEQ ID NO: 11-14 are also provided, and encoded protein thereof is shown as SEQ ID NO: 15-18; a receptor gene of the bactrocera dorsalis neuropeptide sNPF shown as SEQ ID NO: 19 is also provided, and encoded protein thereof is shown as SEQ ID NO: 20; application of the nucleotide sequences and an amino acid sequence, and a nested PCR amplification method of the bactrocera dorsalis neuropeptide sNPF gene and the receptor genes thereof are also provided. The application prospect is good in the aspect of preparing fruit fly pesticides.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a neuropeptide sNPF and its receptor gene and its application in Bactrocera dorsalis specific control agent. Background technique [0002] Citrus is an important economic crop. With the adjustment of my country's agricultural industry structure, the scale of the citrus industry has continued to expand, and it has gradually become a pillar industry in many regions. Bactrocera dorsalis is a serious threat to many economically important fruits and vegetables, especially citrus, due to its strong environmental adaptability and ability to invade and spread. At present, Bactrocera dorsalis has become a huge threat to the healthy development of the citrus industry. At present, Bactrocera dorsalis has developed severe resistance to pesticides such as organophosphorus insecticides, pyrethroids, and avermectins on the market; pesticide residues seriously pollute the environm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/575C07K14/72C12N15/16C12N15/10C12N15/12A01N47/44A01P7/04
CPCA01N47/44C07K14/575C07K14/723C12N15/102
Inventor 王进军桂顺华李慧敏蒋红波
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products