Neuropeptide natalisin and its receptor gene and its application in specific control agent of Bactrocera dorsalis

A technology of natalisin-2-r and natalisin-2-f, which is applied in the field of genetic engineering and achieves good application prospects

Inactive Publication Date: 2019-03-19
SOUTHWEST UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, GPCRs in insects are rarely reported as pesticide targets, and the application in Bactrocera dorsalis is even less.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neuropeptide natalisin and its receptor gene and its application in specific control agent of Bactrocera dorsalis
  • Neuropeptide natalisin and its receptor gene and its application in specific control agent of Bactrocera dorsalis
  • Neuropeptide natalisin and its receptor gene and its application in specific control agent of Bactrocera dorsalis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1, Obtaining the Open Reading Frame Sequence of Bacteralis dorsalis Neuropeptide Natalisin and Its Receptor

[0041] 1. Primer design and amplification of the open reading frame sequence of Bacteralis dorsalis neuropeptide Natalisin and its receptor

[0042] Based on genome and transcriptome data, using bioinformatics methods, after repeated analysis and comparison of Drosophila Natalisin (Genbank No. NM001170137) and its Natalisin receptor (Genbank No. CG6515), the neuropeptide Natalisin and its The nested PCR specific primers of the acceptor, the sequence is as follows:

[0043]

[0044] The total RNA of B. dorsalis was extracted with an RNA extraction kit, and reverse transcribed into cDNA with a reverse transcription kit.

[0045]Amplification of Bacteralis dorsalis neuropeptide Natalisin sequence: 50ul reaction system containing 24μL deionized water, 20μL 2×PrimeSTAR Max Premix, primers Natalisin-1-F (as shown in SEQ ID NO: 1 in the sequence listing), N...

Embodiment 2

[0060] Example 2. Determination of the Binding Ability of Bacteralis dorsalis Neuropeptide Natalisin and Its Receptor Based on the Intracellular Calcium Ion Flow Detection Method

[0061] 1. Construction of Bacteralis dorsalis Natalisin receptor CHO (Chinese hamster ovary cell) cell expression plasmid

[0062] The Bacteralis dorsalis neuropeptide Natalisin acceptor plasmid and pcDNA3.1 (+) plasmid connected on the T carrier recovered in Example 1 were connected (T4 DNA ligase) after NotI single enzyme digestion respectively, and connected Then refer to the transformation method in Example 1 for transformation, and after the positive identification of the bacterial liquid is correct (PCR detection with the universal primer T7 / BGH, T7: TAATACGACTCACTATAGGG, BGH: TAGAAGGCACAGTCGAGG), the plasmid is extracted with a plasmid extraction kit, and the construction is obtained pcDNA3.1(+) plasmid with NTLR fragment.

[0063] Co-transfection:

[0064] 1) Prepare 1.5mL serum-free mediu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses neuropeptide Natalisin, a receptor gene thereof and application of the neuropeptide Natalisin in a citrus fruit fly specificity control agent. The gene of the citrus fruit fly neuropeptide Natalisin is shown in SEQ ID NO:9, and the protein coded by the gene is shown in SEQ ID NO:10. The nucleotide sequences of mature peptides of the citrus fruit fly neuropeptide Natalisin are shown in SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:13, and the proteins coded by the mature peptides are shown in SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:16. The receptor gene of the citrus fruit fly neuropeptide Natalisin is shown in SEQ ID NO:17, and the protein coded by the receptor gene is shown in SEQ ID NO:18. The invention further provides the application of nucleotide sequences and amino acid sequences, the citrus fruit fly neuropeptide Natalisin and a nested type PCR amplification method of the receptor gene of the citrus fruit fly neuropeptide Natalisin.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a neuropeptide Natalisin, its receptor gene and its application in a Bactrocera dorsalis specific control agent. Background technique [0002] Citrus is an important economic crop. With the adjustment of my country's agricultural industry structure, the scale of citrus industry has continued to expand, and it has gradually become a pillar industry in many regions. Bactrocera dorsalis is a serious threat to many economically important fruits and vegetables, especially citrus, due to its strong environmental adaptability and ability to invade and spread. At present, Bactrocera dorsalis has become a huge threat to the healthy development of the citrus industry. At present, Bactrocera dorsalis has developed severe resistance to pesticides such as organophosphorus insecticides, pyrethroids, and avermectins on the market; pesticide residues seriously pollute the environm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/16C07K14/575C12N15/10C12N15/12C07K14/72
CPCC07K14/575C07K14/723C12N15/1096C12Q2531/113C12Q2549/119
Inventor 蒋红波桂顺华刘小强王进军
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap