Check patentability & draft patents in minutes with Patsnap Eureka AI!

An attenuated strain of Salmonella choleraesuis and its preparation method and application

A technology for Salmonella cholerae and poisonous pigs, which is applied in the field of attenuated Salmonella choleraesuis and its preparation, can solve problems such as not being very clear, and achieve the effect of excellent attenuating effect

Inactive Publication Date: 2019-06-21
SICHUAN AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, it is not yet clear whether other methods can be used to attenuate S. choleraesuis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An attenuated strain of Salmonella choleraesuis and its preparation method and application
  • An attenuated strain of Salmonella choleraesuis and its preparation method and application
  • An attenuated strain of Salmonella choleraesuis and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1. Primer design (for the construction and identification of mutant strains)

[0041] Referring to the whole genome sequence of Salmonella choleraesuis SC-67, two pairs of primers were designed to delete the wzx gene (Dwzx-1F / DwbaD-1R, Dwzx-2F / Dwzx-2R). The upstream and downstream fragments of wzx gene: up-wzx (upper homologous arm) and down-wzx (lower homologous arm) were amplified from Salmonella choleraesuis C3545 respectively, and the sizes of the amplified fragments were 346bp and 333bp respectively.

[0042] Dwzx-1F: CCGCTGATGGAAGTGCGAACG

[0043] Dwzx-1R: ggttaacttattttactttccggatgtaaac

[0044] Dwzx-2F: gtaaaataagttaaccaagcgggaaaatatc

[0045] Dwzx-2R: GATTCAACAAACTCTTTCACCG

[0046] 2. Construction of the C3545wzx mutant strain of Salmonella choleraesuis

[0047] Using the extracted Salmonella choleraesuis C3545 genome as a template, primers Dwzx-1F / Dwzx-1R and Dwzx-2F / Dwzx-2R were used to amplify the upstream and downstream homology arms of the wzx gene, res...

experiment example 1

[0053] Phenotypic Characterization of Experimental Example 1 Gene Deletion Strain

[0054] We will compare and observe the lipopolysaccharides of the strain obtained in Example 1 and the wild strain, which are important immunogens or virulence factors of Salmonella choleraesuis.

[0055] Lipopolysaccharide extraction and silver staining observation: extract a small amount of LPS for silver staining observation, the specific steps are: take 2-3mL each of the bacterial strain obtained in Example 1 and the wild strain cultivated overnight, centrifuge at 1,2000×g for 1min, Collect the cells; wash the cells with PBS or ultrapure water 2 to 3 times; take 150 μL lysis buffer (1 mL 0.5M Tris-cl pH=6.8, 0.8 mL glycerol, 1.6 mL 10% SDS, 0.4 mL β-mercaptoethanol, 4.2 mL Ultrapure water), mix the cells and cook in boiling water for 10 minutes; cool the sample to room temperature, centrifuge at 1,2000×g, 4°C for 10 minutes; take 10 μL of the supernatant and add it to 90 μL loading buffer (...

experiment example 2

[0057] Experimental example 2 Determination of attenuation effect of Salmonella choleraesuis wzx gene deletion strain

[0058] In order to determine the attenuation effect of the constructed gene deletion strain C3545Δwzx, the virulence changes of the gene deletion strain and the parental strain on mice were compared by oral administration. In this experiment, six-week-old BALB / c female mice were purchased, fed for one week to adapt to the environment, and then challenged by oral routes. There were 3 mice in each group, a total of eight groups, of which six groups were mutant strains, one group was a blank group that took BSG orally, and one group was oral administration of BSG. It is the positive control group of oral wild strain C3545. Oral dose of mutant strain was 1×10 8 CFU and 1×10 9 CFU, the oral dose of the positive control group was 1×10 5 CFU and 1×10 6 CFU. After the challenge, the mice were fed for 4 weeks, and their growth status was observed and recorded eve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides attenuated salmonella choleraesuis (S.Cholerasuis S1209). The attenuated salmonella choleraesuis is characterized by deleting a wzx gene, having the class name of S.Cholerasuis S1209, and being collected in China Center for Type Culture Collection on October 22, 2015, with the collection number of CCTCC M 2015631. The invention further provides a preparation method of the attenuated salmonella choleraesuis (S.Cholerasuis S1209) and application thereof to vaccines.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an attenuated strain of Salmonella choleraesuis and its preparation method and application. Background technique [0002] With the continuous prevalence of new and old infectious diseases, it is extremely urgent to research and develop effective methods for preventing and treating infectious diseases. In the past two hundred years, vaccines have played a huge role in preventing bacterial or viral infectious diseases. Since vaccines have the advantage of low cost compared with most drugs, continuous research and development of vaccines is very necessary. [0003] In the field of vaccine research, the use of Salmonella as a vector has been extensively studied. However, at present, the virulence genes of Salmonella, especially certain Salmonella (such as Salmonella choleraesuis), have not been fully studied. Over the past two decades, there have been few attenuated Salmon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/74A61K39/112A61P31/04C12R1/42
Inventor 孔庆科刘田刘青赵新新
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More