Unlock instant, AI-driven research and patent intelligence for your innovation.

Prawn white spot syndrome virus LAMP primer, kit and detection method

A white spot virus and detection method technology, applied in the field of shrimp white spot virus LAMP primers, can solve the problems of no effective control measures for the virus, difficult to achieve sensitivity, loss of shrimp farming, etc., and achieve good practical value, low detection cost, and high sensitivity. Effect

Inactive Publication Date: 2016-11-16
陈定虎
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, expensive equipment and instruments are required, and professionally trained technicians are required. This problem has always plagued the front-line testing technicians.
Due to the very low content of WSSV virus in prawns, especially at the initial stage of infection, even if prawns bring a small amount of virus into shrimp ponds, because WSSV has the characteristics of horizontal transmission, under suitable environmental conditions, The virus will also multiply and spread quickly, causing devastating losses to shrimp farming. At present, there are still no effective control measures for the virus. Therefore, more sensitive detection methods must be continuously researched to spread the virus. minimize the possibility of
And for the virus like WSSV, because its virus-carrying rate is very low, so the detection method with very high sensitivity can detect potential WSSV. Urgent need to study new detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prawn white spot syndrome virus LAMP primer, kit and detection method
  • Prawn white spot syndrome virus LAMP primer, kit and detection method
  • Prawn white spot syndrome virus LAMP primer, kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] A kind of shrimp white spot virus LAMP primer of the present invention comprises:

[0082] Forward primer F3: 5'GTTGAAGAAATGAGACCGG3';

[0083] Reverse outer primer B3: 5'GGTTTGTAGGCTAATGTCCAT3';

[0084] Forward Inward Primer FIP:

[0085] 5'AACACCACTAGTGGTCTACCTCTCTT-TCAATGAAGCATCCGAAAC3';

[0086] wherein the forward inner primer FIP comprises F1c and F2:

[0087] F1c: 5'AACACCACTAGTGTCTACCTCTCTT3';

[0088] F2: 5'TCAATGAAGCATCCGAAAAC3';

[0089] Reverse inner primer BIP:

[0090] 5'TTGCTCCTGCAATAGCTGGC-GCCTCTTTTCATATTCTTTCCTT3';

[0091] Wherein the reverse inner primer BIP includes B1c and B2:

[0092] Wherein B1c: 5'TTGCTCCTGCAATAGCTGGC3';

[0093] B2: 5'GCCTCTTTTCATATTCTTTCCTT3'.

Embodiment 2

[0095] A shrimp white spot virus LAMP kit of the present invention, the kit includes:

[0096]

[0097] Wherein the primers include:

[0098] Forward primer F3: 5'GTTGAAGAAATGAGACCGG3';

[0099] Reverse outer primer B3: 5'GGTTTGTAGGCTAATGTCCAT3';

[0100] Forward Inward Primer FIP:

[0101] 5'AACACCACTAGTGGTCTACCTCTCTT-TCAATGAAGCATCCGAAAC3';

[0102] wherein the forward inner primer FIP comprises F1c and F2:

[0103] F1c: 5'AACACCACTAGTGTCTACCTCTCTT3';

[0104] F2: 5'TCAATGAAGCATCCGAAAAC3';

[0105] Reverse inner primer BIP:

[0106] 5'TTGCTCCTGCAATAGCTGGC-GCCTCTTTTCATATTCTTTCCTT3';

[0107] Wherein the reverse inner primer BIP includes B1c and B2:

[0108] Wherein B1c: 5'TTGCTCCTGCAATAGCTGGC3';

[0109] B2:5'GCCTCTTTTCATATTCTTTCCTT3';

[0110] Among them, the product specification of the kit: 40 times.

[0111] The primers include 1.6 μl forward outer primer F3, 1.6 μl reverse outer primer B3, 0.2 μl forward inner primer FIP, and 0.2 μl reverse inner primer BIP....

Embodiment 3

[0113] A method for detecting prawn white spot virus LAMP of the present invention comprises the following steps:

[0114] A, extracting sample DNA; wherein said sample is dried shrimp;

[0115] B. Establish a LAMP reaction system:

[0116] Take various reagents from the kit according to the required reaction volume, put them into sterilized test tubes, and prepare a premix on ice; flick the sterilized test tube to mix it up, and centrifuge briefly for a few seconds to concentrate the solution in the sterilized test tube. Bottom of tube; 20 μL LAMP reaction includes:

[0117]

[0118]

[0119] C. Add sample:

[0120] Add 5 μL of the RNA of the sample to be tested, the negative control reaction sample, and the positive control reaction sample to three sterilized test tubes containing 20 μL of LAMP reaction body, respectively, to make the total amount of each to reach 25 μL, cover the test tube cap and tap lightly Mix and centrifuge briefly to concentrate the reaction s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses prawn white spot virus LAMP primers, a kit and a detection method, wherein the primers include: a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP, and a reverse inner primer BIP. The purpose of the present invention is to provide a kind of prawn white spot virus LAMP primer in order to overcome the deficiencies in the prior art; Another purpose of the present invention is to provide a kind of test kit comprising above-mentioned primer; Another purpose of the present invention is to provide A method for detecting prawn white spot virus by using the above kit, the detection method has the characteristics of strong primer specificity, simple and fast equipment, high detection sensitivity, closed-tube detection, simple operation, and the results can be directly interpreted and the like.

Description

technical field [0001] The present invention relates to a prawn white spot virus LAMP primer, and the present invention also relates to a kit comprising the above primer; the present invention also relates to a method for detecting prawn white spot virus by using the above kit. Background technique [0002] White spot syndrome virus and WSSV have caused serious harm to the aquatic crustacean breeding industry around the world. It is the animal virus with the largest known genome. Since it first occurred in Taiwan in the early 1990s, it has given Shrimp farming in various countries in the world has caused huge economic losses. In 2009, it was listed as a Class I animal disease virus for aquatic organisms by the Ministry of Agriculture's "List of Category I, II and III Animal Diseases". Virus genomes have been extensively studied. Moreover, the host range of white spot syndrome virus infection is very wide. It not only infects various wild and farmed shrimps, but also infects...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/701C12Q1/6844
Inventor 陈定虎管维
Owner 陈定虎