43results about How to "Good primer specificity" patented technology

The invention discloses a hypsizygus marmoreus GJ5 strain as well as SSR marker primers and application thereof. The preservation number of the hypsizygus marmoreus GJ5 strain is CCTCC M 2020506; theSSR marker primers comprise five pairs of SSR specific marker primer combinations, and the five pairs of SSR specific marker primers form a fingerprint spectrum. The application comprises the following detection steps: extracting genome DNA of hyphae or sporocarp of a strain to be detected; carrying out SSR molecular marker amplification; carrying out electrophoresis detection; and comparing an electrophoretic band with the fingerprint spectrum, wherein the bacterial strain consistent with the fingerprint spectrum is the hypsizygus marmoreus GJ5 strain. Compared with conventional morphologicaldetection, antagonism experiments and fruiting experiment methods, the SSR fingerprint has the advantages of being short in detection time, high in accuracy, good in repeatability and the like, and the SSR fingerprint constructed through the SSR fingerprint can be used for distinguishing the hypsizygus marmoreus GJ5 strain from 23 main cultivated varieties of hypsizygus marmoreus.

The invention relates to the biological detection technology, in particular to primers for detecting citrus canker pathogenic bacteria and a detection method thereof. The invention aims to provide the primers and method for dual PCR-DHPLC detection of the citrus canker pathogenic bacteria. The primers for detecting the citrus canker pathogenic bacteria of the invention have good primer specificity and high detection sensitivity; and the detection method of the invention has high accuracy and high sensitivity and can quickly and simply judge whether a sample has the citrus canker pathogenic bacteria or not, thereby ensuring the safety in import and export.

The invention discloses a kit for diagnosing Von Hippel-Lindau (VHL) disease. The kit for diagnosing the VHL disease comprises a primer pair 1 consisting of deoxyribonucleic acid (DNA) molecules shown as SEQ ID No.1 and DNA molecules shown as SEQ ID No.2, a primer pair 2 consisting of DNA molecules shown as SEQ ID No.3 and DNA molecules shown as SEQ ID No.4, and a primer pair 3 consisting of DNA molecules shown as SEQ ID No.5 and DNA molecules shown as SEQ ID No.6. Experiments prove that the kit ensures that a polymerase chain reaction (PCR) amplification product has a specific strip and hardly has a mixed strip, has a specific, clear and accurate sequencing result, and does not have any uncertain alkali group, namely the primers in the kit have high specificity, and a few mixed strips exist; and the kit provides convenience for screening family members with the VHL disease, and lays a foundation for fulfilling the aims of early discovery, early diagnosis and early treatment.

The invention discloses a detection primer, a probe and a detection method of human astrovirus nucleotide, belonging to the technical field of biological detection. The detection primer of the human astrovirus nucleotide comprises a forward primer and a reverse primer, the nucleotide sequences of which are shown as SEQ NO.1 and SEQ NO.2. A nucleotide sequence of the probe which is matched with the detection primer is shown as SEQ NO.3; and one end of the probe is signed with a report fluorescent dye, and the other end of the probe is signed with a quenching fluorescent dye. The detection method of the human astrovirus nucleotide comprises the following steps of: carrying out real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) amplification by taking a sample RNA (Ribonucleic Acid) to be detected as a template and utilizing the forward primer, the reverse primer and the probe, collecting data after every one circulation is finished, and judging a result according to an amplification curve after the reaction is finished. The primer designed according to a human astrovirus genomic sequence is good in specificity and is high in sensitivity when being used for real-time fluorescent RT-PCR detection.

The invention provides two primer pairs. One primer pair includes nucleotide sequences shown as SEQ ID NO:1 and SEQ ID NO:2, and the other primer pair includes nucleotide sequences shown as SEQ ID NO:3 and SEQ ID NO:4. The invention further provides application of the two primer pairs in preparing products for detecting the Zika virus. The invention further provides a reagent kit comprising the two primer pairs and application. As proved by experiments, the two primer pairs are good in specificity and repeatability and high in sensitivity, and a Zika virus detecting method established based on the two primer pairs can be used for sensitively, accurately, stably and rapidly detecting whether the Zika virus exists or not and has great significance on clinical rapid diagnosis and public prevention and control over the Zika virus in China.

The invention discloses a method, primer, probe and kit for detecting cronobacter sakazakii. The primer and probe for fluorogenic quantitative PCR detection are designed according to a conserved sequence of a cronobacter sakazakii genome; fluorogenic quantitative PCR detection technique of cronobacter sakazakii is established; and whether cronobacter sakazakii exists can be determined according to an amplification curve after a reaction is over. The sequence of the primer comprises an upstream primer sequence of 5'GGGATACGCAGGAGGTGGCA' and a downstream primer sequence of 5'GATGCTGCCTGCCAGCAGG'. The sequence of the probe is 5'CATTTTAGCGCTTGATACTCCCCTGGGC'. According to the invention, the method for detecting cronobacter sakazakii is good in accuracy and high in sensitivity, and whether cronobacter sakazakii exists in a sample can be fast and simply determined.

The present invention relates to a primer, a probe and a kit for detecting Coxsackievirus A16 nucleic acid. The nucleotide sequence of the primer is: forward primer 5'-GAACCATCACTCCACACAGGAG-3'; reverse primer 5'-GTACCCGTGGTGGGCATTG-3'. The nucleotide of the probe is 5'-CAGCCATTGGGAATTTCTTTAGCCGTG-3'. Also provided is a method for detecting Coxsackievirus A16 nucleic acid. The method uses sample RNA as a template, uses the above primers and probes to perform real-time fluorescent RT-PCR amplification, and judges the result according to the amplification curve after each cycle. The invention has good primer specificity, fast and simple detection method, high accuracy and high sensitivity, and provides scientific basis for etiological diagnosis and differential diagnosis of hand, foot and mouth disease and related diseases.

The invention discloses a rice GS3 mutant gene and a molecular marker and application thereof. The rice GS3 mutant gene is obtained by deleting three CTC bases behind the 5932 base of the rice GS3 gene, and the mutation site is located at the fifth exon. The invention also discloses a molecular marker aiming at the molecular marker, further discloses a molecular marker combination containingthe molecular marker, and provides application. According to the invention, key variation of grain shape regulation of the fifth exon of the rice GS3 gene is discovered and identified, 3bp deletion mutation participates in regulation of grain shape traits of rice, and the mutation can be used as another screening target for grain shape improvement breeding in the future. The invention develops aneffective dCaps marker and molecular marker combination which can be used for distinguishing and selecting rice grain types, identifying varieties, breeding rice and the like.

The invention provides a primer for quantitatively determining Twist-1 gene expression quantity in mesenchymal stem cells, a standard product and a detection method. The primer sequence is shown as SEQ ID No: 1 and SEQ ID No: 2. The detection method comprises the following steps of extracting total RNA of the mesenchymal stem cells; then performing inverse transcription to synthesize cDNA; using cDNA as a template; using the primer for PCR amplification; recovering and purifying amplification products for preparing plasmid standard products; drawing a standard curve; using cDNA of a sample tobe tested as a template; using the primer for fluorescent quantitative PCR reaction to obtain a Ct value of a sample to be tested; calculating the copy number of Twist-1 genes in the sample to be tested according to the standard curve. When the primer, the standard product and the detection method provided by the invention are used for performing repeated detection on the Twist-1 gene expression quantity in the mesenchymal stem cells, the repeated performance is good; the accuracy is high; the sensitivity is high; the detection time is short.

The invention relates to a hybridized membrane strip capable of being used for medically diagnosing genetic non-syndromic deafness of people, in particular to a non-syndromic deafness gene detection membrane strip and a PCR (polymerase chain reaction) primer used for amplifying gene segments of a to-be-detected sample. The gene detection membrane strip comprises a substrate as well as normal contrast probes and specific mutation detection probes which are fixed on the substrate and totally comprises 20 mutation detection probes for detecting 20 gene mutation sites and 10 normal contrast probes. The gene detection membrane strip can detect 20 gene mutation sites in 20 mutation types, is used for detection, can directly diagnose the gene types of a to-be-detected person and has the advantages of being high in accuracy, high in specificity, capable of detecting a recessive gene carrier and the like.

The invention discloses a method of detecting nucleotides of Bacillus cereus, primers for detecting and probes, belonging to the technical field of biological detection. According to the invention, the primers designed according to genome sequence of the Bacillus cereus are good in singularity, and high in sensitivity if used for fluorescence PCR detection. The detection method provided by the invention is high in accuracy and sensitivity, can rapidly and simply determine whether samples contain the Bacillus cereus, and provides scientific basis for etiological diagnosis and differential diagnosis of the Bacillus cereus in various dairy products.

The invention discloses a one-step droplet digital PCR method for quantitatively detecting the GII type norovirus in fruits and vegetables. According to the method, RT-ddPCR is utilized, a primer and a probe for RT-qPCR detection of the GII type norovirus are combined for use, reaction is carried out, and then the high-sensitivity rapid detection for the GII type norovirus is realized. The method is high in sensitivity and can achieve about 2copies / [mu] L, but the sensitivity of the conventional RT-qPCR is usually 10 copies / [mu] L; the amplification efficiency is high, the amplification efficiency is 95.4%, R2 is equal to 0.9973. Under low copy number, compared with RT-qPCR, the method provided by the invention can more effectively avoid the influences of inhibitors in fruits and vegetables, and the false negative generation is reduced. Therefore, the detection method provided by the invention is sensitive, accurate and visual, a novel detection method is provided for the government departments including the agriculture department and the inspection and quarantine bureau, and related detection mechanisms and enterprises, and guiding significance is also achieved.