25 results about "Genome alignment" patented technology

The invention discloses a conservative non-coding element identification method and system based on multi-species genome alignment, and the method comprises the following steps: establishing an index database based on reference genome sequences of multiple species, completing whole genome alignment, and further processing to obtain a high-credibility chain alignment result; the multi-species chain type comparison results are integrated into multi-sequence comparison data in a unified format; on this basis, a neutral evolution model is constructed based on quadruple degenerate sites, and candidate conservative regions are predicted through conservative scoring; in combination with genome annotation information, a length threshold is set, and a coding region and a UTR region are rejected, so that a high-confidence non-coding conservative element is obtained; and finally, displaying a cross-species conservative distribution diagram of the CNE by utilizing a visual tool. According to the method, the CNE with a potential regulation function can be accurately, efficiently and automatically identified, and technical support is provided for regulation system analysis, functional gene mining and molecular breeding of various organisms.

This invention discloses a molecular marker, primer pair, kit, and its application and method for identifying gynogenetic offspring of red crucian carp induced by blunt snout bream. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. Based on resequencing analysis and genome alignment of gynogenetic offspring of red crucian carp induced by blunt snout bream, this invention screens for paternal gene fragments from blunt snout bream and develops primer pairs with blunt snout bream molecular markers and specificity. This effectively identifies gynogenetic offspring of red crucian carp induced by blunt snout bream, effectively avoiding the identification difficulties caused by morphological differences. The method of this invention is simple, rapid, and highly accurate, and can play an important role in the field of fish genetics and breeding.

The application relates to application of a wheat stripe rust genome SNP site combination in wheat stripe rust gene typing, wherein the wheat stripe rust genome SNP site combination comprises 9365 SNP sites, the physical positions of the 9365 SNP sites are determined based on wheat stripe rust reference genome Pst_104E_v13_all_ctg alignment; and the physical position information of the 9365 SNP sites is shown in Table 1. The application can efficiently, conveniently, accurately, economically and rapidly perform wheat stripe rust gene typing detection with high coverage.

The application selects highly conservative and excellent interspecies specificity UL49A gene as a target from multiple strains of HSV-1 and related herpes simplex virus (HSV-2, EBV, CMVh and VZV) coding sequences through bioinformatics whole genome alignment, designs and selects specific primer probe combination 124F / 124R / 124P, and establishes a HSV-1 probe method fluorescence quantitative PCR detection system targeting UL49A gene. Based on the primer probe group, the HSV-1 detection kit can be prepared, which is suitable for clinical biological samples such as lesion secretions, aqueous humor and blood, especially can provide a rapid, accurate and high-sensitivity etiological diagnosis scheme for HSV-1 related keratitis, and has good clinical application value.

The application discloses a specific molecular marker screening method for microbial tracing, comprising the following steps: step one, microbial genome characteristic analysis; step two, specific candidate gene screening; step three, homologous arm design and target fragment amplification; step four, recombination plasmid construction; step five, positive control system establishment; step six, specificity verification; step seven, sensitivity detection; step eight, stability evaluation; step nine, marker practicability verification; and step ten, standardization and shaping; the unique gene fragment of the target microorganism is screened through whole genome alignment, and multiple verifications such as specificity, sensitivity, stability and practicability are combined, so that the screened molecular marker has high specificity, can effectively distinguish the target microorganism from the non-target microorganism close to the target microorganism, and cross reaction is avoided.

The invention discloses a corn genetic typing primer combination suitable for a nanopore sequencing platform and application, the primer combination comprises at least one of 11 pairs of ONT primers, and the sequences of the primers are shown as SEQ ID NO: 1-SEQ ID NO: 22. The primer can specifically amplify a target area with rich heritable variation in a corn genome, PCR products obtained through amplification are mixed and then subjected to nanopore on-machine sequencing, the target rate of the amplification products is counted by analyzing species attributes and genome comparison positions of sequencing sequences and combining experimental data of a to-be-detected sample, known genome information is associated, and the target area of the to-be-detected sample can be identified according to the target rate of the to-be-detected sample and the target area of the to-be-detected sample. And the purity and identification accuracy of the corn seeds are judged. The primer combination has maize material specificity and intra-population compatibility, can economically and efficiently complete genotype identification of maize inbred lines and hybrid population offspring, and can be applied to maize variety authenticity verification and breeding material genetic background analysis and screening.

The application discloses a HIV-1 drug-resistant gene detection method based on NGS technology, belongs to the technical field of gene detection, adopts a series of processes such as NGS data quality control and filtration, genome alignment and extraction of effective information, construction of consistent sequences, construction of a pseudo-reference genome, HIVdb drug resistance detection, visualization of NGS sequencing results and HIVdb drug resistance detection results, a traceability evolution tree and final output results to complete HIV-1 drug-resistant gene detection. Compared with traditional first-generation Sanger sequencing technology, the system and method adopt the application, can detect drug-resistant sites with a mutation frequency of less than 10%, have higher detection sensitivity, and have important significance for early screening and detection of HIV-1 virus and doctors to formulate more effective drug use schemes after the onset.

The present disclosure provides at least one method for detecting at least one cancer through cell-free DNA (cfDNA) methylation patterns in a subject Method comprises: obtaining a plurality of methylation sequencing (methSeq) reads from cfDNA of said subject; analysing said methylSeq reads using a bioinformatics pipeline to obtain a genomic alignment and a methylation status for each methylSeq read; filtering a first type of methSeq reads from a second type of methSeq reads depending upon their conversion extents; deriving at least one score using said first type of methSeq reads; and applying a predictive model to said at least one score to determine presence of said at least one cancer and a tissue of origin of said at least one cancer in said subject. Disclosed also is a diagnostic device for detecting at least one cancer through cell-free DNA (cfDNA) methylation patterns in a subject.

This invention discloses a primer combination for maize genotyping suitable for nanopore sequencing platforms and its application. The primer combination includes at least one of 11 pairs of ONT primers, the sequences of which are shown in SEQ ID NO: 1-SEQ ID NO: 22. The primers of this invention can specifically amplify target regions rich in genetic variation in the maize genome. The amplified PCR products are mixed and then sequenced using nanopore sequencing. By analyzing the species attributes and genome alignment positions of the sequencing sequences, combining experimental data from the test samples to calculate the targeting rate of the amplified products, and associating them with known genomic information, the purity and identification accuracy of maize seeds can be determined. This primer combination combines maize material specificity with population compatibility, enabling economical and efficient genotyping of maize inbred lines and hybrid populations. It can also be applied to verify the authenticity of maize varieties, analyze the genetic background of breeding materials, and screen for genotyping.

The invention discloses a banana fusarium oxysporum 4 # physiological race rapid detection method based on an enzyme-mediated double-index amplification technology. The detection primer group comprises the following components: F4: AAGCTAATACGACTCACATAGGGAAACTGATCCCTCAAACCAGCGG, F6: AAGCTAATACGACACCAGCGG, F7: AAGCTAATACGACACACCAGCGG R1 is CATACTTACAAGCTTATACAAGCGTTT, and R2 is And N1 is FAM-GAAGAGUUAAACAGGAAGUGGUCAGAGA-BHQ1, and N1 is Based on an enzyme-mediated double exponential amplification technology (EmDEA), Foc4 specific gene segments are screened through genome comparison, six pairs of DNA primers and six RNA probes are designed, an optimal combination (F4R1N1) is obtained through cross screening, and a set of high-sensitivity and high-specificity detection system is developed. Experimental results show that amplification of the system is completed within 30 min under the constant temperature condition of 42 DEG C, the lowest detection limit is 0.5 pg / mu L, specificity is high, cross reaction with sibling species is avoided, and efficient technical support is provided for field early warning and port quarantine of banana fusarium wilt.

The invention discloses a chicken population genotyping liquid chip based on a combined site of structural variation and single nucleotide polymorphism and a detection method of the chicken population genotyping liquid chip, and belongs to the technical field of animal molecular markers. The chip integrates 24 chromosome level chicken genomes, 16 HiFi sequencing data sets and 2018 parts of whole genome re-sequencing data (WGS), and 36958 loci, including 5267 SV-GWAS and SNP-GWAS significant loci and 31691 typing background SV loci, are obtained by integrating genome comparison and HiFi data joint identification SV strategies and combining multi-software cross validation screening. According to the detection method, target fragments are enriched through probe hybridization, next-generation sequencing typing is carried out, and high-throughput genotyping of chicken populations is achieved. The blank of the chicken high-density SV chip is filled, and the chicken high-density SV chip has the advantages of accurate typing, controllable cost and high phenotype explanation rate.

The application discloses a method for detecting genomic structural variations between distant species, comprising the following steps: step S1, preprocessing the genomes of different species to be detected which meet the requirements of distant species; step S2, taking the reference species genome as a benchmark, and performing pairwise alignment by using LASTZ; step S3, integrating the obtained alignment results by using MULTIZ, and generating a multi-genome alignment task processing alignment task file in batches; step S4, generating an alignment block optimization task in batches, and performing filtering and realignment of alignment blocks on a multi-sequence alignment file; step S5, in a high-confidence MAF file, identifying insertion, deletion, inversion, intrachromosomal translocation and interchromosomal translocation operations, and generating a BED format variation result file; and step S6, a program generates a variation detection task to calculate the average consistency of the flanking sequences of each structural variation breakpoint in the variation result file. The method is suitable for efficient, accurate and low resource consumption genomic structural variation detection of distant species.

The application belongs to the field of bioinformatics, and particularly relates to a method and device for processing high-throughput sequencing data of FFPE nucleic acid samples. By adopting a specific algorithm designed in the application, abnormal soft-cut sequences can be identified, and reads with abnormal soft-cut can be removed from a genome alignment file, thereby improving the accuracy and analysis speed of downstream analysis.

This invention relates to a low-memory multi-genome alignment and structural variation integration method for ultra-large-scale closely related genome sets. It solves the problems of existing multi-sequence / multi-genome alignment methods, which suffer from unacceptable time and space overhead on ultra-long sequences, large errors, and inefficiency in identification and integration. It includes S1, sequence input, output, and center sequence preprocessing; S2, direction determination and anchor point retrieval; S3, main strand construction, loop divide-and-conquer, and banded dynamic programming for fine alignment; and S4, structural difference strand identification, block output, and consistent integration. The advantages of this invention are: it can losslessly preserve and integrate structural variation fragments related to inversions and rearrangements during global alignment, ensuring that the output meets the "column consistency" requirements of downstream analysis while expressing strand direction and rearrangement information, and avoiding the extremely slow or even unworkable problems of traditional multiple merging processes in ultra-large file scenarios.

The application discloses a Lentinula edodes Jingxian 206 strain, specific molecular markers and application thereof, relates to the field of agricultural microorganisms and molecular biology technologies. The Jingxian 206 strain is a hybrid strain obtained by taking Lentinula edodes 0912 as a parent strain, and has a preservation number of CGMCC No. 41673. The fruit body agronomic characters of the Jingxian 206 strain are systematically evaluated through three mushroom production pilot tests and one mushroom production pilot test. The results show that the Jingxian 206 strain has the advantages of early mushroom production, high yield of head mushroom, good uniformity of fruit bodies and the like, and has a good industrial application prospect. According to whole genome alignment analysis, specific variation sites of the Jingxian 206 strain are mined, specific molecular markers are designed based on the specific variation sites, and accurate identification and effective protection of the Jingxian 206 strain are realized.

The invention discloses a molecular marker, a primer pair and a kit for identifying megalobrama amblycephala-induced red crucian carp gynogenesis progeny as well as application and a method of the molecular marker. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1. The invention further discloses a method for identifying megalobrama amblycephala-induced red crucian carp gynogenesis progeny. Based on re-sequencing analysis and genome comparison of megalobrama amblycephala-induced gynogenesis progeny of the red crucian carp, a male parent gene segment from megalobrama amblycephala is screened, and a primer pair with megalobrama amblycephala molecular marker and specificity is developed, so that the megalobrama amblycephala-induced gynogenesis progeny of the red crucian carp can be effectively identified, and the application prospect of the megalobrama amblycephala-induced gynogenesis progeny is broad. The method effectively avoids the problem that identification is difficult due to the fact that appearance is difficult to distinguish, is simple, rapid and high in accuracy, and can play an important role in the field of fish genetic breeding.

This invention discloses a Mycoplasma caprineis subspecies Mccp NM strain and its applications. Whole-genome alignment of this strain revealed 422 missense mutations, 132 frameshift mutations, and several key insertion / deletion variations compared to the existing vaccine strain C87001. In virulence studies, at a concentration of 1×10⁻⁶... 9 In healthy, susceptible goats, intratracheal injection at a CCU / mL dose resulted in all experimental goats exhibiting typical symptoms of caprine contagious pleuropneumonia. Autopsy revealed pleural effusion and liver-like lesions in the lungs. The inactivated vaccine prepared using this strain demonstrated good safety in goats. Challenge protection tests showed that the vaccine of this invention provided 100% protection against homologous challenge with the NM strain and 80% protection against the heterologous C87002 strain, while commercially available vaccines offered only 40% protection against the NM strain. This invention overcomes the deficiency of existing vaccines in providing insufficient protection against clinical variants, offering an effective technical reserve and candidate vaccine for addressing immunization failure caused by Mccp antigen mutations.

The invention discloses a KASP primer group of an aegilops tauschii 4D chromosome, a kit and application, and belongs to the technical field of molecular biology. The kit comprises six KASP primer groups, each primer group comprises two forward primers and one reverse primer, and the specific sequences of the primers are as shown in SEQ ID NO.1-18. After the aegilops tauschii and common wheat are subjected to whole genome comparison, the specific SNP of the aegilops tauschii is obtained through screening, and then the corresponding specific marker is developed, so that the marker developed by the invention can be used for tracking and detecting 4D chromosome introgression fragments or genes which are rich in genetic variation and originated from Straangula type aegilops tauschii AT23; the method has important value for genetic breeding improvement of common wheat.

The invention provides a biological sample data analysis method. The method is applied to the technical field of data processing and comprises the steps that a generic genome graph and sequencing read length data of a biological sample are obtained, the generic genome graph is dynamically divided into a plurality of sub-graphs through hierarchical graph segmentation, and the segmentation density is automatically adjusted according to variation complexity of a genome region; performing topology-aware dynamic programming comparison on sequencing read length data in each sub-graph, and simultaneously processing sequence positions, node positions and path selection through a three-dimensional scoring matrix to generate corresponding sub-graph comparison results; combining all subgraph comparison results based on a minimum cost flow algorithm, and constructing a globally consistent genome comparison path; and detecting structural variation according to the global comparison path, and outputting a variation data set containing accurate breakpoint coordinates. In this way, the accuracy of biological sample data analysis can be improved.

The invention discloses an early-maturing shiitake Jingxiang 206 strain as well as a specific molecular marker and application thereof, and relates to the technical field of agricultural microorganisms and molecular biology. The Jingxiang 206 strain is a hybrid strain obtained by taking mushroom 0912 as a parent, and the preservation number of the Jingxiang 206 strain is CGMCC (China General Microbiological Culture Collection Center) No.41673. The agronomic characters of the sporocarp of the Jingxiang 206 strain are systematically evaluated through three fruiting small-scale tests and one fruiting pilot-scale test. The result shows that the Jingxiang 206 strain has the advantages of early fruiting, high first flush mushroom yield, good sporocarp uniformity and the like, and has a good industrial application prospect. A specific variation site of the Jingxiang 206 strain is excavated according to whole genome comparative analysis, and a specific molecular marker is designed based on the specific variation site, so that accurate identification and effective protection of the Jingxiang 206 strain are realized.

The present application relates to the technical field of bioinformatics, in particular to a biological information analysis system based on large model technology, which comprises a data analysis calibration module, a problem disintegration module, an analysis task arrangement module, a result mapping module and a feedback iteration module.In the present application, dynamic calibration of genome alignment and clinical phenotype timestamp eliminates time sequence misplacement deviation, base complementary pairing combined protein network abnormal screening enhances low-abundance collaborative variation capture, genotype-phenotype discrete distribution quantization unifies multi-modal data benchmark, solves multi-source heterogeneous standardization loss, classifies and integrates pathogenic gene semantic weight, balances statistical threshold and biological function, dynamically optimizes analysis sequence to synchronously cover key mutation area, improves non-coding region function annotation, integrates gene expression clustering and protein network topology in three-dimensional distribution, breaks through two-dimensional space limitation, and reduces genetic heterogeneity false positive rate through closed-loop feedback correction threshold iteration elimination rule.

The invention discloses a chromosome karyotype analysis method, device and equipment and a medium, and relates to the technical field of chromosome analysis, and the method comprises the following steps: carrying out genome comparison on whole exome sequencing data of a biological sample to be detected based on a preset mapping relation file to obtain a target counting matrix of a sequencing read segment, performing variation detection on the whole exome sequencing data to obtain a variation detection result file; determining sequencing read difference information and statistical significance information according to the target counting matrix and the standard counting matrix to obtain a first karyotype result; counting the number of variation sites of each chromosome of the biological sample to be detected based on the variation detection result file, and calculating allele frequency value density distribution of target chromosomes of which the number of variation sites reaches a preset variation site number threshold to analyze the target chromosomes to obtain a second karyotype result; and determining a target chromosome karyotype analysis result according to the first karyotype result and the second karyotype result. And full-exome sequencing data is directly and automatically processed.

The application provides a Streptococcus salivarius strain, the strain name is Streptococcus salivarius A2, which has been preserved in the China Center for Type Culture Collection on October 23, 2023, and the preservation number is CCTCC NO: M20231986. The new Streptococcus salivarius strain screened in the application is subjected to genome comparison with a current Streptococcus salivarius model strain, and the average similarity (ANIb) of the genome with the model strain is 94.14%-95.86%, at least 4% more than other strains, and the maximum difference reaches nearly 6%. The Streptococcus salivarius has a significant effect on the treatment of colorectal inflammation and colorectal cancer.

The application discloses a method and device for identifying CNEs (Conserved Non-coding Elements) in a genome. The method comprises: aligning each of a plurality of high-quality genomes with a reference genome to obtain genome alignment results; identifying a species evolution relationship topological structure and the genome alignment results to obtain a conserved sequence position information gff file; filtering the gff file to obtain a CNEs.gff file; extracting CNEs sequences from the CNEs.gff file; determining CNEs differentiation sequences according to the CNEs sequences; and performing functional enrichment analysis on target genes of the CNEs differentiation sequences to obtain CNEs identification results in the plurality of high-quality genomes. The application solves the technical problem in the related art that the identification of CNEs is often affected by genome structural variations, resulting in incomplete identification of CNEs or misjudgment.

This invention relates to an AI-based early tumor screening system that couples the nucleosome localization cycle and mutation phase characteristics of cfDNA, belonging to the field of in vitro diagnostic technology. The system includes: a sample processing and nucleic acid extraction unit, which collects peripheral blood from subjects, purifies the plasma through two-stage centrifugation, extracts circulating cell-free DNA, and assesses its quality; a sequencing execution and data calibration unit, which constructs a library and performs whole-genome sequencing, removes abnormal fragments through quality control screening, removes repetitive sequences and corrects for biases after alignment with a human reference genome, and outputs standardized data; a core feature analysis and extraction unit, which identifies the nucleosome localization center, determines the orientation characteristics of DNA entanglement with histones, and integrates multimodal information to construct a core feature combination; and a model construction and risk assessment unit, which converts the features into a risk score and generates a screening report containing the risk level. This system achieves non-invasive, accurate, and efficient early tumor screening, covering a variety of common cancer types, and provides reliable support for early clinical diagnosis and treatment.