Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and method for detecting Nanog gene expression quantity during mesenchymal stem cell passage

A technology of gene expression and qualitative stem cells, which is applied in the detection field of primers and detection of Nanog gene expression in the process of passage of mesenchymal stem cells, can solve the problems of low sensitivity, low detection efficiency, poor accuracy, etc., and achieve high sensitivity High, good primer specificity, good accuracy

Inactive Publication Date: 2016-08-24
CHENGDU ZHONGCHUANG QINGKE MEDICAL LAB CO LTD
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the above-mentioned problems in the prior art, the present invention provides a primer and a detection method for detecting the expression level of the Nanog gene in the passage of mesenchymal stem cells, which can effectively solve the problems of low detection efficiency and sensitivity in the prior art. Low, poor accuracy issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for detecting Nanog gene expression quantity during mesenchymal stem cell passage
  • Primer and method for detecting Nanog gene expression quantity during mesenchymal stem cell passage
  • Primer and method for detecting Nanog gene expression quantity during mesenchymal stem cell passage

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] A method for detecting the amount of Nanog gene expression during in vitro passage of mesenchymal stem cells, comprising the following steps:

[0026] (1) Extraction of mesenchymal stem cells

[0027] UC-MSCs: After rinsing the umbilical cord with normal saline in a biological safety cabinet, peel off the amniotic epithelium, remove the umbilical artery and umbilical vein, then cut the umbilical cord jelly into pieces and add 30mL type Ⅱ collagenase, place at 37°C, 200r The digestion was continued for 6 h at 100 mesh sieve, and then centrifuged at 1200 r / min for 10 min, the supernatant was discarded, and the cells were gently washed with D-Hank's solution for 3 times, and the cells were resuspended in serum-free medium (hyclone company). 5% CO at 37°C 2 After culturing in a constant temperature incubator for 6-7 days, change the medium completely, discard non-adherent cells, and separate UC-MSCs from other tissue cells according to the difference in adhesion. After sep...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer for detecting the Nanog gene expression quantity during mesenchymal stem cell passage. The primer comprises Nanog-F ATGCCTGGTGAACCCGAC, Nanog-R AGGACTGGATGTTCTGGGT, beta-actin-F CACGAAACTACCTTCAACTCC and beta-actin-R CATACTCCTGCTTGCTGATC. A method for detecting the Nanog gene expression quantity during mesenchymal stem cell passage includes steps of (1), extracting mesenchymal stem cells and carrying out subculturing; (2), extracting total RNA (ribonucleic acid) in each generation of mesenchymal stem cells and carrying out RT-PCR (reverse transcription-polymerase chain reaction) amplification; (3), carrying out real-time fluorescent quantitative PCR amplification on amplified genes by the aid of the primer. The primer and the method have the advantages that the primer is good in specificity and high in accuracy and sensitivity, the method is simple, and subtle change of the gene expression quantity can be detected by the aid of the primer and the method.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a primer and a detection method for detecting the expression amount of Nanog gene in the passage process of mesenchymal stem cells. Background technique [0002] In 2003, Chambers et al. and Mitsui et al. reported almost simultaneously a new transcription factor expressed in blastocyst inner cell mass (ICM), primordial germ cells and embryonic stem cells (ESCs), named Nanog . The Nanog gene belongs to the ANTP class, the NK family gene, and is located on chromosome 12 12p13-31 in humans. Its cDNA consists of 2184 nucleotides, contains an open reading frame, and encodes a polypeptide consisting of 305 amino acids. [0003] The discovery of the Nanog gene is the greatest progress in the study of genes related to the maintenance of ESCs subpotency and embryonic development. In addition to helping ESCs self-renew and maintain their undifferentiated state, it can also promote...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6851C12Q2545/101C12Q2563/107
Inventor 刘宇张蓉马明李晓瑞林秀芳
Owner CHENGDU ZHONGCHUANG QINGKE MEDICAL LAB CO LTD