Quadruple PCR detection method capable of identifying canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2

A technology of canine parainfluenza virus and canine distemper virus, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, and microorganism measurement/testing, can solve mixed infection, time-consuming, difficult clinical differential diagnosis and other problems, Achieve the effect of good specificity, simple operation and fast detection speed

Active Publication Date: 2017-03-22
INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The clinical symptoms of the above four canine diseases are similar, and they are prone to mixed infection. The clinical differential diagnosis is very difficult. The commonly used single PCR method is time-consuming and long. Therefore, it is of great significance to establish a differential diagnosis method that can detect these four diseases simultaneously Practicality and practical significance, so that effective treatment and prevention and control measures can be taken as soon as possible to reduce the harm caused by these diseases to the dog industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quadruple PCR detection method capable of identifying canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2
  • Quadruple PCR detection method capable of identifying canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2
  • Quadruple PCR detection method capable of identifying canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Primer Design

[0030] According to the conserved sequences of canine parvovirus gene, canine distemper virus gene, canine parainfluenza virus gene and canine adenovirus type 2 gene, a pair of specific primers were designed for canine parvovirus gene, canine distemper virus gene gene, canine parainfluenza virus gene and canine adenovirus type 2 gene partial gene fragments. The fragment lengths of the expected amplified products were 1033bp, 804bp, 396bp and 258bp, respectively. The sequences of the primers are as follows:

[0031] Canine parvovirus gene amplification primers:

[0032] CPVP1: 5' ACGGTGGTCAACCTGCTGTC 3' (SEQ ID NO: 1);

[0033] CPVP2: 5'AATGGCCCTTGTGTAGACGC 3' (SEQ ID NO: 2);

[0034] Canine distemper virus gene amplification primers:

[0035] CDVP1: 5' GGGTCAGGTAGGAGACAAAGGC 3' (SEQ ID NO: 3);

[0036] CDVP2: 5'AGACACCAAGGTCCGAGCACAG 3' (SEQ ID NO: 4);

[0037] Canine parainfluenza virus gene amplification primers:

[0038] CPIVP1: 5' T...

Embodiment 2

[0044] Embodiment 2 Quadruple PCR detection method

[0045] 1) Extraction of DNA: According to the operating instructions of Axygen's Viral Genome DNA / RNA Extraction Kit, extract the viral genome and store it at -20°C for later use.

[0046] 2) Quadruple PCR amplification reaction

[0047] Add 7.5 μL of sterilized water, 12.5 μL of 2×1 step buffer, 0.25 μL of CPV upstream and downstream primers (20 pmol / μL), 0.25 μL of CDV upstream and downstream primers (20 pmol / μL), and CPIV 0.25 μL each of upstream and downstream primers (20 pmol / μL), 0.25 μL each of CAV-2 upstream and downstream primers (20 pmol / μL), 1 μL of primescript 1 step enzyme mix, 2 μL of template, and a total of 25 μl of RT-PCR amplification system.

[0048] PCR reaction program: 50°C, 30min; 95°C pre-denaturation for 2 minutes; then 95°C, 30s, 53°C, 30s, 72°C, 30s, a total of 30 cycles; finally 72°C extension for 7min; 4°C storage.

[0049] Result observation: The PCR products were subjected to 1.2% agarose gel...

Embodiment 3

[0050] Embodiment 3 specificity test

[0051]According to the method of Example 2, using the quadruple PCR detection method, the genome extracted from the canine quadruple live vaccine (canine parvovirus disease, canine distemper, canine parainfluenza and canine adenovirus type 2) was used as a template, and sterilized Water was used as a negative control to verify the specificity of the RT-PCR method.

[0052] PCR products were subjected to 1.2% agarose gel electrophoresis, and the results were shown in figure 1 .

[0053] figure 1 The results showed that the PCR products amplified by the primers of canine parvovirus, canine distemper virus, canine parainfluenza virus and canine adenovirus type 2 had a fragment at about 1033bp, 804bp, 396bp and 258bp respectively, and the PCR products amplified by the quadruple primers There were 4 bands in the PCR product, consistent with the expected size, but no bands appeared in the sterile water control, feline distemper, canine adeno...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quadruple PCR detection method capable of identifying canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2, belonging to the field of virus detection. With the adoption of the method, four viruses including canine parvovirus, hundestaupe virus, canine parainfluenza virus and canine adenovirus type-2 can be simultaneously detected, the operation is simple, the detection speed is high, and the throughput is high; the accuracy is high, the specificity is good, the repeatability is good, the analysis can be accurately and rapidly carried out at high throughput, and the method is suitable for being popularized and applied in clinical practice. A primer provided by the invention is good in specificity, can be combined with the four target viral nucleic acids needing to be detected, and can not be combined with other common viral nucleic acids, such as feline distemper, canine adenovirus type I and leptospira canicola.

Description

technical field [0001] The invention belongs to the field of virus detection, in particular to a quadruple PCR detection method for distinguishing canine parvovirus, canine distemper virus, canine parainfluenza virus and canine adenovirus type 2. Background technique [0002] Canine distemper, canine parvovirus, canine parainfluenza, and canine adenovirus type 2 are common infectious diseases in dogs with high morbidity and mortality, causing serious losses to the dog industry. Canine parvovirus disease is an acute infectious disease of dogs caused by canine parvovirus (Canine Parvovirus, CPV), characterized by acute hemorrhagic gastroenteritis or non-suppurative myocarditis, and dogs of all ages and genders are prone to Sensitive, but the susceptibility of puppies is higher, the case fatality rate reaches 50%. Canine distemper is caused by canine distemper virus (Canine Distemper Virus, CDV), a highly contagious disease of many animals in dogs and carnivores, characterized...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/701C12Q2600/16
Inventor温肖会曾宪淇吕殿红魏文康翟少伦
OwnerINST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI