Method, primer, probe and kit for detecting cronobacter sakazakii

A Sakazaki Cronor rod and probe technology, which is applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc. It is unable to adapt to the specific detection of Cronobacter, and nucleic acid detection methods have not been reported, so as to avoid subjectivity, have a wide range of applications, and improve specificity.

Inactive Publication Date: 2015-09-09
SOUTH CHINA UNIV OF TECH +1
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] 2) Existing molecular methods cannot adapt to the specific detection of Cronobacter species with high DNA homology
In 2012, the cgcA gene was first used in the rapid typing research of Cronobacter, but the nucleic acid detection method of Cronobacter based on the cgcA gene has not been reported
[0008] 3) Existing detection methods cannot meet the requirements of rapidity, specificity and high throughput

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, primer, probe and kit for detecting cronobacter sakazakii
  • Method, primer, probe and kit for detecting cronobacter sakazakii
  • Method, primer, probe and kit for detecting cronobacter sakazakii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] A method for detecting Cronobacter sakazakii, carried out according to the following steps:

[0044] 1. Design and synthesis of primers and probes

[0045] Download all genome sequences of Cronobacter sakazakii from the NCBI database, and select a highly conserved segment (SEQ ID NO: 1) with no secondary structure through comparative analysis of the sequences. The sequence is as follows: CGCTGTACATTCGCCCCTTTGATGAAAGCGTGCTGAATAAAGATCTCTCAGACAGCCCGCTTTTTAC CGCGCCAGGGCAGCGCCACCTGGCTGTCGGCGC TTGCGCGCTCGACGCGTTACCCGATTGTCGTGGTGGC GCGCGACCTGGCTTAAAACAGTATTCCCGATTTGCTTATCAACGGTGCGCTGCTGACTGCCATTATCCTGATGGGCA

[0046] Among them, bold italics are the upstream and downstream primer sequences, and bold underlines are the probe sequences.

[0047] Primers and Taqman probes were designed for the above segments using the biological software Primer Express 3.0. And the Blast homology comparison verification was carried out through the NCBI database to ensure that the sequence ...

Embodiment 2

[0076] The extracted Kronobacter sakazakii ATCC 29544 DNA was diluted with DEPC (diethylpyrocarbonate)-treated water gradient to 4.6×10 7 , 4.6×10 6 , 4.6×10 5 , 4.6×10 4 , 4.6×10 3 , 4.6×10 2 , 4.6×10 1 Copy number / mL, utilize the fluorescent quantitative PCR reaction system that establishs in embodiment 1 to carry out relative sensitivity detection, detection result is as follows figure 2 shown.

[0077] The results confirmed that the detection limit of Cronobacter sakazakii reached 460 template copies / ml.

Embodiment 3

[0079]Infant formula milk powder was taken, and it was tested to be free of Cronobacter sakazakii contamination according to the GB 4789.40-2010 method. Take 1ml of bacterial suspension with a concentration of 10cfu / ml and mix it evenly in 25g of infant formula milk powder, let it stand for 10min, add 225ml of BPW (buffered peptone water) bacterial enrichment solution, mix evenly, culture at 37°C, and incubate at 4h, 6h, After 12h, 18h, and 24h, take 1ml of enrichment solution, centrifuge at 4000r / min for 10min, carefully pick out the upper layer of fat, centrifuge at 12000r / min for 5min, discard the supernatant, and extract DNA as shown in Example 1. Fluorescent PCR detection was performed according to the PCR reaction conditions established in Example 1, and DEPC water was used as a negative control.

[0080] The result is as image 3 As shown, using fluorescent quantitative PCR to detect artificially contaminated infant formula milk powder with a dose of 10cfu / 25g homogena...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, primer, probe and kit for detecting cronobacter sakazakii. The primer and probe for fluorogenic quantitative PCR detection are designed according to a conserved sequence of a cronobacter sakazakii genome; fluorogenic quantitative PCR detection technique of cronobacter sakazakii is established; and whether cronobacter sakazakii exists can be determined according to an amplification curve after a reaction is over. The sequence of the primer comprises an upstream primer sequence of 5'GGGATACGCAGGAGGTGGCA' and a downstream primer sequence of 5'GATGCTGCCTGCCAGCAGG'. The sequence of the probe is 5'CATTTTAGCGCTTGATACTCCCCTGGGC'. According to the invention, the method for detecting cronobacter sakazakii is good in accuracy and high in sensitivity, and whether cronobacter sakazakii exists in a sample can be fast and simply determined.

Description

technical field [0001] The invention relates to biological detection technology, in particular to nucleotide primers and probes of Cronobacter sakazakii and a method for detecting Cronobacter sakazakii. Background technique [0002] Cronobacter sakazakii (Cronobactersakazakii), formerly known as Enterobactersakazakii (Enterobactersakazakii), is a gram-negative, non-spore-forming bacterium with perinatal flagella, motile, and facultatively anaerobic. Its epidemiological survey shows that most of its infection cases are infants and young children, mainly causing bacteremia, meningitis, necrotizing enteroconjunctivitis, etc., accompanied by severe neurological sequelae. As an opportunistic pathogen, it has a lethality rate as high as 40% to 80% for special populations. Cronobacter is widely distributed in various food and food raw materials such as infant milk powder, cheese, cured meat, water, vegetables, rice, bread, tea, herbs, condiments and tofu. With the outbreak of a s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/04C12N15/11C12Q1/68
CPCY02A50/30
Inventor胡双芳肖性龙李蓉余以刚庄平
OwnerSOUTH CHINA UNIV OF TECH