QPCR (quantitative polymerase chain reaction) primer for detecting NS2 genes of rice stripe viruses

A rice streak virus, target gene technology, applied in microorganism-based methods, DNA/RNA fragments, microorganisms, etc., can solve the problem of less protein research, and achieve the effect of reasonable primer dosage and guaranteed specificity

Pending Publication Date: 2015-11-25
FUJIAN AGRI & FORESTRY UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Rice stripe virus ( Rice stripe virus , RSV) is the causative agent of rice stripe blight, it is a parvovirus ( Tenuivirus ), which is composed of 4 single-stranded RNAs and encodes 7 proteins in total. NS2 is one of them, but there are few studies on this protein at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • QPCR (quantitative polymerase chain reaction) primer for detecting NS2 genes of rice stripe viruses
  • QPCR (quantitative polymerase chain reaction) primer for detecting NS2 genes of rice stripe viruses
  • QPCR (quantitative polymerase chain reaction) primer for detecting NS2 genes of rice stripe viruses

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0053] Example 1 Primer Specificity Detection

[0054] rice stripe virus Rice stripe virus , RSV), rice grass dwarf disease ( Ricegrass systunt virus , RGSV), rice sawtooth virus ( Riceragged stunt virus , RRSV) cDNA as a template, the primer sequence is NS2-qPCRF: ATCAACAGACGGAGCATC; NS2-qPCRR: CATTGGTTACAACTATGTGCTT. According to the following PCR system and procedures:

[0055] PCR reaction system:

[0056]

[0057] PCR reaction conditions:

[0058]

[0059] Judgment of results: After the reaction, judge the specificity of the primers according to the agarose electrophoresis graph. The electrophoresis graph shows that only the cDNA of RSV can amplify the band, and the band is single without primer-dimer, while the cDNA of RGSV and RRSV cannot. Amplified bands ( figure 1 ), which shows that the primer can specifically detect the gene of RSV NS2 .

example 2

[0061] Rice stripe virus ( Rice stripe virus , RSV), rice grass dwarf disease ( Ricegrass systunt virus , RGSV), rice sawtooth virus ( Riceragged stunt virus , RRSV) cDNA as a template, according to the following system and procedures (3 repetitions for each sample):

[0062] PCR reaction system:

[0063]

[0064] PCR reaction conditions:

[0065]

[0066] Result judgment: after the reaction finishes, judge the result according to the amplification curve diagram, and the RSV sample begins to peak at a Ct value of 20-25 and the peak value is high ( figure 2 ); while other samples only start peaking when the Ct value is higher than 35, and the peak value is low. Therefore, if the primer can peak before the Ct value is 30 ( image 3 ), it can be judged as the gene of RSV NS2 , otherwise, it cannot be judged.

example 3

[0068] Using the rice cDNA infected with RSV as a template, the rice elongation factor eEF1A (GenBank accession number: GQ848058) is an internal reference gene, which is carried out according to the following system and procedures (3 replicates for each sample):

[0069]

[0070] PCR reaction conditions:

[0071]

[0072] Judgment of results: After the reaction, according to the peak value of each sample and the qPCR calculation formula, the NS2 The expression level analysis graph of , which is a bar graph, and the height of the bar indicates the target gene in the RSV-infected rice sample NS2 The relative expression level can be judged by the graph NS2 The level of expression ( Figure 4 ), which shows that the primer can be used as a detection RSV NS2 qPCR primers for relative gene expression.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention relates to a qPCR (quantitative polymerase chain reaction) primer for detecting NS2 genes of rice stripe viruses and a detection method of the qPCR primer. The sequence of the primer includes ATCAACAGACGGAGCATC for NS2-qPCRF and GATTGGTTACAACTATGTGCTT for NS2-qPCRR. GC content of the primer is 36-50%, amplified fragments are 107bp, specificity is high, primer dimers do not exist, standard curves corresponding to the premier meet the requirements of the qPCR premier, and accordingly, the qPCR primer is quite suitable for detection of corresponding target gene expression quantity of the primer.

Description

technical field [0001] The invention belongs to the field of biological detection, in particular to a method for detecting rice stripe virus NS2 qPCR primers for gene expression. Background technique [0002] Rice is widely distributed in China and is an important food crop in my country. However, rice virus diseases have seriously affected the yield and quality of rice in China. Rice stripe virus disease (Ricestripevirusdisease) is one of rice virus diseases, which can cause rice yield reduction or even grain failure, known as "cancer" on rice. [0003] Rice stripe virus ( Rice stripe virus , RSV) is the causative agent of rice stripe blight, it is a parvovirus ( Tenuivirus ), which is composed of 4 single-stranded RNAs and encodes 7 proteins in total. NS2 is one of the proteins, but there are few studies on this protein at present. In 2011, NS2 was identified by our research group as a weak silencing suppressor, and it interacted with rice-encoded gene silencing supp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/701
Inventor郑璐平林辰贺杰吴康成吴祖建
OwnerFUJIAN AGRI & FORESTRY UNIV