Kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and application of CPNE3

A prognostic assessment and kit technology, applied in the directions of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of excessive treatment intensity of patients, difficulties in stratified diagnosis and individualized treatment, and insufficient treatment intensity of patients. And other issues

Active Publication Date: 2016-12-21
石金龙
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to the NCCN (National Comprehensive Cancer Network) risk stratification guidelines, more than half of the AMLs are classified into the intermediate-risk group (including all normal karyotype acute myeloid leukemia Cytogenetically Normal AML, CN-AML), the existing technology lacks Effective markers for risk stratification and clinical prognosis evaluation. Therefore, it is very difficult to stratify the diagnosis and individualized treatment of AML clinically. It is urgent to find effective prognostic markers to confirm the intensity of treatment for such patients, in order to achieve Precise individualized treatment can avoid excessive treatment intensity for some patients with good prognosis, which will bring many unnecessary complications, and also avoid insufficient treatment intensity for other patients with poor prognosis, which will eventually lead to leukemia recurrence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and application of CPNE3
  • Kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and application of CPNE3
  • Kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and application of CPNE3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] The extraction of embodiment 1 total RNA

[0104] During the experimental operation, micropipettes, Tips, and EP tubes related to RNA extraction and detection must be treated without RNase.

[0105] 1. Cell lysis: Add 1ml of QIAZOL reagent to the collected cell pellet, shake and mix with an oscillator, and let it work at room temperature for more than 15 minutes to fully lyse it. If RNA cannot be extracted immediately after adding QIAZOL reagent, it can be stored at -20°C and can be used in a short time.

[0106] 2. According to the volume ratio of chloroform: QIAZOL 1:4, add about 300 μl chloroform, mix upside down for 1 minute, let stand at room temperature for 5-10 minutes, and centrifuge at 4°C, 12600rpm for 10 minutes.

[0107] 3. After centrifugation, the liquid in the EP tube is divided into three layers, the upper layer is the supernatant containing RNA, and the middle and lower layers are DNA and protein. Then, transfer the supernatant to a new EP tube, add a...

Embodiment 2

[0111] Example 2 RNA reverse transcription

[0112] 1. Prepare the reverse transcription system according to Table 1, the total reaction volume is 25 μl (total RNA amount is 1 μg). The following operations were performed on ice:

[0113] Table 1 Preparation of reverse transcription system

[0114]

[0115] 2. After preparing the above reaction components into 0.2ml PCR reaction tubes, put them into a PCR instrument for reverse transcription reaction. The program is 37°C, 2h; 4°C, forever. The product obtained after the reaction is cDNA, and the reaction product is taken out and stored at -20°C until use.

Embodiment 3

[0116] Embodiment 3 real-time fluorescent quantitative PCR detection

[0117] 1. Prepare real time PCR mix according to Table 2.

[0118] 2. In the reaction tube, prepare 2 times the volume of 2×SYBR GreenⅠ, Nuclease-free water, template cDNA and ROXⅡ mixture, mix well and divide into two 0.2ml PCR reaction tubes, and then add the target gene calcium-dependent Annexin 3 gene SEQ ID NO: primer pair SEQ ID NO: 2 and SEQ ID NO: 3 and internal reference GAPDH primer (glyceraldehyde-3-phosphate dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase), gently Mix well.

[0119] 3. Put the reaction tube into a real-time fluorescent quantitative PCR instrument for PCR amplification. The reaction program is 95°C, 1 minute; 95°C, 5s; 60°C, 20s; a total of 40 cycles. Then 95°C, 1 minute; 60°C, 1 minute, 95°C, 30s. The fluorescence collection point was at 60°C. After the reaction, the PCR product SEQ ID NO: 4 was taken out, and the size of the PCR amplification product was 203.

[0120]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and an application of CPNE3, namely a gene chip and the kit for conducting risk stratification or clinical prognosis evaluation on patients with adult AML, wherein primer pairs of calcium-dependent membrane combined proteins copine III genes are used, and the sequences of one of the primer pairs are shown as agactcccacgaaactcagg (SEQ ID NO:2) and ctgtgcgctcaacctcatac (SEQ ID NO:3) or complementary sequences thereof, and the primer pairs are used for detecting the expression level of calcium-dependent membrane combined proteins in adult AML cells or tissues.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the detection of acute myeloid leukemia genes, acute myeloid leukemia risk stratification or clinical prognosis assessment, in particular to the detection of adult acute myeloid leukemia genes, gene chips and kits. Background technique [0002] Acute myeloid leukemia (acute myeloid leukemia, AML) is a highly heterogeneous malignant blood disease, accounting for about 80% of adult acute leukemia (see MROZEK K, HEEREMA N A, BLOOMFIELD C D., Cytogenetics in acute leukemia[ J]. Blood reviews, 2004, 18(2): 115-36), which includes many entities with different genetic abnormalities and clinical features, and the prognosis is highly heterogeneous. In the NCCN (National Comprehensive Cancer Network) risk stratification guidelines, more than half of AML is classified as intermediate risk group (including all normal karyotype acute myeloid leukemia Cytogenetically Normal AML, CN-AML), the existin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C40B40/06
CPCC12Q1/6837C12Q1/686C12Q1/6886C12Q2600/112C12Q2600/118C40B40/06C12Q2561/113C12Q2563/107C12Q2545/114C12Q2531/113
Inventor石金龙付林付华平王卫东
Owner石金龙