42 results about "Membrane bound protein" patented technology

PCT No. PCT/AU92/00141 Sec. 371 Date Nov. 30, 1992 Sec. 102(e) Date Nov. 30, 1992 PCT Filed Apr. 2, 1992 PCT Pub. No. WO92/17167 PCT Pub. Date Oct. 15, 1992There are disclosed complexes and compositions for oral delivery of a substance or substances to the circulation or lymphatic drainage system of a host. The complexes of the invention comprise a microparticle coupled to at least one carrier, the carrier being capable of enabling the complex to be transported to the circulation or lymphatic drainage system via the mucosal epithelium of the host, and the microparticle entrapping or encapsulating, or being capable of entrapping or encapsulating, the substance(s). Examples of suitable carriers are mucosal binding proteins, bacterial adhesins, viral adhesins, toxin binding subunits, lectins, Vitamin B12 and analogues or derivatives of Vitamin B12 possessing binding activity to Castle's intrinsic factor.

Disclosed are amphiphilic compounds comprising Formula I:wherein R1, R2, and R3 are C2-C12 straight or branched alkyl; unsubstituted phenyl, biphenyl, C3-C8 cycloalkyl, or C3-C8 cycloalkenyl; or phenyl, biphenyl, C3-C8 cycloalkyl, or C3-C8 cycloalkenyl substituted with one, two, or three C1-C6 straight or branched alkyl groups; or R1 and R2 combined are C3-C8 cycloalkyl, C3-C8 cycloalkenyl; or C3-C8 cycloalkyl or C3-C8 cycloalkenyl substituted with one, two, or three C1-C6 straight or branched alkyl groups; one of R4 or R5 is selected from the group consisting of C2-C6-straight or branched alkyl-(dimethyl-N-oxide), alkyl-(dimethylamine), alkyl-(trimethylammonium), alkyl-glucosyl, alkyl-maltosyl, glucosyl, maltosyl, and polyethylene(glycosyl); the other of R4 or R5 is selected from the group consisting of H, C2-C6 straight or branched alkyl or alkenyl, C2-C6-straight or branched alkyl-(dimethyl-N-oxide); alkyl-(dimethylamine), alkyl-(trimethylammonium), alkyl-glucosyl, alkyl-maltosyl, glucosyl, maltosyl, and polyethylene(glycosyl); and salts thereof. The compounds are detergents useful in the solubilization of membrane-bound proteins.

This invention provides methods for producing a membrane-bound protein in mammalian cells. This invention also provides nucleic acids for making novel fusion proteins (e.g., GPCR fusion proteins). This invention further provides related bacterial expression vectors; expression methods; fusion proteins; bacterial cells; GPCR vector screens; bacterial spheroplasts; methods for making anti-GPCR antibodies; and GPCR binding screens. This invention also provides a method for identifying a reagent in which a membrane protein is likely to crystallize. Finally, this invention provides methods for producing crystals of a protein which, in a cell, is a membrane-bound protein.

The present invention overcomes the problems and disadvantages associated with prior art arrays by providing an array comprising a plurality of biological membrane microspots associated with a surface of a substrate that can be produced, used and stored, not in an aqueous environment, but in an environment exposed to air under ambient or controlled humidities. Preferably, the biological membrane microspots comprise a membrane bound protein. Most preferably, the membrane bound protein is a G-protein coupled receptor, an ion channel or a receptor tyrosine kinase.

The present invention overcomes the problems and disadvantages associated with prior art arrays by providing an array comprising a plurality of biological membrane microspots associated with a surface of a substrate that can be produced, used and stored, not in an aqueous environment, but in an environment exposed to air under ambient or controlled humidities. Preferably, the biological membrane microspots comprise a membrane bound protein. Most preferably, the membrane bound protein is a G-protein coupled receptor, an ion channel, a receptor serine/threonine kinase or a receptor tyrosine kinase.

The present invention provides nucleic acid molecules encoding annexin 1 (ANX1) and annexin 4 (ANX4) that belong to a multigene family of calcium-dependent membrane binding proteins. ANX1 and ANX4 are inducible by abscisic acid (ABA), salt and other various stress treatments. The anx1 and anx4 mutant plants are characterized by their hypersensitivity to salt and ABA during seed germination and early seedling growth. The invention can be utilized to generate transgenic plants that are tolerant to environmental stress.

The present invention provides a method of screening for agents which may regulate or inhibit the activities of TACE and TGF-α. These agents may act by enhancing or inhibiting the activity of DGK-δ. An activity of DGK-δ is the enzymatic conversion of DAG to PA. The method includes contacting a cell or organism with a test agent determining the activity of DGK-δ within the cell. An agent with reduces or increases the activity of DGK may be used to regulate or inhibit the activity of TACE and TGF-α. Such agents can be used to treat diseases such as cancer where cell growth and division and inflamation are important factors.

A heteropentamer composed of a fusion monomer (32) comprising a fusion protein of an antigenic amino acid sequence and an amino acid sequence of a monomer of a mucous membrane-binding protein and a nonfusion monomer (20) of an amino acid sequence of a monomer of a mucous membrane-binding protein. A homopentamer composed of a fusion monomer including a fusion protein of an antigen derived from an envelope protein of Japanese encephalitis virus and an amino acid sequence of a monomer of a mucous membrane-binding protein. These heteropentamer and the homopentamer can be used as a vaccine.

Novel uses of biological membrane microarrays and a new product platform or assembly are described. The invention involves cell membranes from different tissues or cells or organelles to fabricate tissue-specific cell membrane microarrays. The invention provides methods for identifying the relative distribution and/or abnormal expression levels of different membrane bound proteins, including G protein coupled receptors, in specific tissues or cells. In addition, the invention provides methods for screening target proteins that interact with membrane receptors.

The invention provides a kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and an application of CPNE3, namely a gene chip and the kit for conducting risk stratification or clinical prognosis evaluation on patients with adult AML, wherein primer pairs of calcium-dependent membrane combined proteins copine III genes are used, and the sequences of one of the primer pairs are shown as agactcccacgaaactcagg (SEQ ID NO:2) and ctgtgcgctcaacctcatac (SEQ ID NO:3) or complementary sequences thereof, and the primer pairs are used for detecting the expression level of calcium-dependent membrane combined proteins in adult AML cells or tissues.

The present invention is drawn to methods of characterization of the properties and functions of SV2 proteins. The invention further includes methods of identifying compounds or agents which modulate the activity of SV2 proteins. Included in these methods is the identification of compounds or agents which modulate the binding of levetiracetam to SV2 proteins, including SV2A. Additionally, the present invention provides biotinylated ligands as a tool to screen chemical libraries and characterize the SV2 proteins. Further, the present invention provides a method of solubilizing and purifying functionally active membrane associated proteins, such as SV2.

A polypeptide, which is expressed on the cell surface as a membrane-bound protein, is glycolyzed at one or more points (i.e., membrane glycoprotein) and has an amino acid sequence that corresponds partially or completely to that of the integrin binding protein p80 (accession #AJ131720) or REV1 (accession #AF206019.) The membrane glycoprotein, is expressed by neoplastic cells and not by non-neoplastic cells as an antigen, specifically binds the human monoclonal antibody PM-2 (DSM number: DSM ACC2600) and is, in addition, N-glycosidically and O-glucosidically linked. A related method is provided for the isolation or production of the antigen and for the use of the latter for producing a medicament for immunization. The isolated antigen can also be used to identify medicaments with an apoptotic cell-proliferation inhibiting action. The membrane glycoprotein can also be used as a tumor marker.

The subject invention concerns novel vectors for the rapid and robust selection for cDNA sequences that encode secreted or membrane-bound proteins. The invention also pertains to methods for cloning secreted or membrane-bound proteins, including proteins encoded by novel members of gene families.

Disclosed are saccharide and phosphocholine derivatives. The derivatives include azide and alkyne derivatives which form one end of a variable length carbon chain. The opposite end of the variable length carbon chain is covalently linked to the saccharide or phosphocholine. The saccharide may be, for instance, a maltoside. The alkyne and azide derivatives of the saccharides and phosphocholine may be reacted together to form amphiphilic molecules useful in cellular membrane studies and applications. By adjusting the length of the carbon chain, the biochemical and biophysical properties of the resultant 1,4-disubstituted 1,2,3-triazole compounds may be custom tailored for the intended application. Resultant molecules may form micelles, bicelle, lipid bilayers and other like structures useful in the isolation and purification of membrane bound or membrane associated proteins and biochemical components. The saccharides and phosphocholine molecules may be alternatively substituted as desired to provide additional flexibility in designing the desired end product.

The object of the present invention is to develop a technique for expressing a functional membrane-bound protein by using baculovirus and insect cell expression system. The present invention provides a method for expressing a functional membrane-bound receptor protein which comprises steps of culturing a host infected with at least one type of recombinant baculovirus which contains a gene encoding an interacting protein and a gene encoding a membrane-bound receptor protein which interacts with said interacting protein to perform its function, and co-expressing said interacting protein and said membrane-bound receptor protein in a budded baculovirus released from said host.

Disclosed in the present invention is a multi-target chimeric antigen receptor. Provided in the present invention is a multi-target chimeric antigen receptor consisting of a main peptide chain and an auxiliary peptide chain; the main peptide chain comprises an antigen binding domain A, an auxiliary peptide chain connecting domain B, a transmembrane domain C and an intracellular signaling domain D; the auxiliary peptide chain comprises a main peptide chain connecting domain F; the antigen binding domain A is a polypeptide having an antigen-binding function; the auxiliary chain connecting domain B and the main peptide connecting domain F are combined with each other; the transmembrane domain C is a transmembrane domain of any membrane-binding protein or a transmembrane protein; and the intracellular signaling domain D comprises a primary signaling region. The multi-target chimeric antigen receptor of the present invention can bind to different antigens through the two antigen binding domains thereof, and mediates specific cell killing; and a cytokine and cytokine receptor complex playing the role of a cytokine are introduced into the multi-target chimeric antigen receptor of the present invention.

A method for producing ACE Inhibitor peptides from a protein source or plasma is disclosed. The method utilizes proteolysis by intestinal, blood-circulating, or membrane-bound proteases. The initial synthesis step could require obtaining a protein source either from a human or animal. A protease is added to either a given plasma protein or plasma and incubated. Following incubation, the protease activity must be quenched using a protease inhibitor to inactivate the protease. After incubation with protease inhibitor, the solution will contain a mixture of bioactive ACE inhibitory peptides and inert peptides. This mixture may be purified to select for the ACE inhibitory peptides through centrifugation. The mixture may also be sterilized to remove any microbial contaminants. The ACE inhibitory peptides can be mixed with protein powders, incorporated into baked good and put into other food products to provide food products with the added benefit of lowering blood pressure.