33 results about "Calcium dependent" patented technology

The present invention relates to ligands capable of binding a calcium dependent binding protein, that comprise an amino acid sequence corresponding to that of a wild type ligand for the calcium dependent binding protein with modification which results in enhanced affinity of the ligand for the calcium dependent binding protein.

Compositions and methods for the treatment of toxoplasmosis, caused by the infectious eukaryotic parasite Toxoplasma gondii (T. gondii) and for the treatment of cryptosporidiosis, caused by the infectious eukaryotic parasites Cryptosporidium parvum (C. parvum) and Cryptosporidium hominus (C. hominus) are described. In particular, the present disclosure is directed to compositions and methods for inhibiting either T. gondii calcium dependent protein kinases (TgCDPKs) or C. parvum and C. hominus calcium dependent protein kinases (CpCDPKs) using pyrazolopyrimidine and / or imidazo[1,5-a]pyrazine inhibitors, of the formula,wherein the variables X, Y, Z, L, R1, and R3 are defined herein.

AnnexinA2 (ANXA2), a member of the Annexin family of calcium-dependent, phospholipid binding proteins, is one of a panel of identified antigens recognized by the post-vaccination sera of patients who demonstrated prolonged disease-free survival following multiple vaccinations. AnnexinA2 is abundantly expressed in pancreatic adenocarcinomas and cell surface / membrane AnnexinA2 increases with the progression from premalignant lesions to invasive pancreatic adenocarcinomas. The cytoplasmic to cell surface translocation of AnnexinA2 expression is critical for pancreatic cancer cell invasion. In addition, phosphorylation of AnnexinA2 at Tyrosine 23 is important for its localization to the cell surface and for the invasion of pancreatic cancer cells. Finally, loss of AnnexinA2 leads to the loss of the Epithelial-Mesenchymal Transition.

The present invention provides nucleic acid molecules encoding annexin 1 (ANX1) and annexin 4 (ANX4) that belong to a multigene family of calcium-dependent membrane binding proteins. ANX1 and ANX4 are inducible by abscisic acid (ABA), salt and other various stress treatments. The anx1 and anx4 mutant plants are characterized by their hypersensitivity to salt and ABA during seed germination and early seedling growth. The invention can be utilized to generate transgenic plants that are tolerant to environmental stress.

Novel human polynucleotide and polypeptide sequences are disclosed that can be used in therapeutic, diagnostic, and pharmacogenomic applications.

The present invention relates to a microorganism belonging to the group of lactic acid bacteria characterized in that it is capable of specifically binding to Streptococcus mutans, wherein the specific binding is (i) resistant to heat treatment; and / or (ii) resistant to protease treatment; and / or (iii) calcium-dependent; and / or (iv) formed within a pH range between 4.5 and 8.5; and / or (v) formed in the presence of saliva. Preferably, the specific binding can be assayed as follows: (a) growing said microorganism to stationary phase; (b) mixing said microorganism with Streptococcus mutans which has been grown to stationary phase; (c) incubating the mixture obtained in step (b) under conditions allowing the formation of aggregates of said microorganism and Streptococcus mutans and (d) detecting aggregates by the occurrence of a pellet. Another aspect of the present invention is an analog or fragment of said microorganism which is thermally inactivated or lyophilized, wherein said analog or fragment retains the capability of specifically binding to Streptococcus mutans. In addition, the present invention encompasses compositions and additives for food, feed or drinks comprising the microorganism belonging to the group of lactic acid bacteria which specifically bind to Streptococcus mutans or an analog or fragment thereof. Moreover, uses of said microorganism or said analog or fragment thereof for the preparation of an anticariogenic or pharmaceutical composition or anticariogenic food or feedstuff as well as methods for producing said compositions or food or feedstuff are provided by the present invention.

The present invention thus provides a method of inhibiting bronchial smooth muscle remodeling in asthma, comprising the step of administering to a subject having asthma an agent that inhibits calcium-dependent mitochondrial biogenesis.

The application provides a method of treating fibrous textile goods comprising treating the fibrous textile goods with an enzyme. This enzyme can be used to covalently link one or more active functional compounds to the fibres and / or to trap one or more acitve functional compound within an inter-fibre matrix and / or within an intra-fibre matrix formed by the action of the enzyme. Preferably, the enzyme is a traglutaminase, especially a calcium-dependent transglutaminase. The enzyme may be used to add primary-amine containing active agents to the textile goods and also for the addition of proteins or peptides that have functional groups linked to them.

The invention provides a kit for adult AML (acute myeloid leukemia) risk stratification and clinical prognosis evaluation and an application of CPNE3, namely a gene chip and the kit for conducting risk stratification or clinical prognosis evaluation on patients with adult AML, wherein primer pairs of calcium-dependent membrane combined proteins copine III genes are used, and the sequences of one of the primer pairs are shown as agactcccacgaaactcagg (SEQ ID NO:2) and ctgtgcgctcaacctcatac (SEQ ID NO:3) or complementary sequences thereof, and the primer pairs are used for detecting the expression level of calcium-dependent membrane combined proteins in adult AML cells or tissues.

Disclosed are the novel glycolipoprotein gintonin isolated and identified from ginseng, a method for preparing the same, and uses thereof. Gintonin causes a transient increase in intracellular free Ca2+ level, which in turn activates endogenous Ca2+-activated chloride channel to elevate intracellular calcium levels. Therefore, the novel glycolipoproteins are useful in the therapy and prophylaxis of calcium deficiency-associated diseases as well as effectively inducing calcium-dependent physiological activities, including adaptogenic activity, immunostimulatory activity, aphrodisiac activity, neuroprotection and neuroactivation, angiogenesis, and antidiabetic activity.

Phospholipase A2 (PLA2) forins are expressed in spinal cord whose inhibition induces a potent antihyperalgesia. PLA2 inhibitor compounds are provided that include a common motif consisting of a 2-oxoamide with a hydrocarbon tail and a four carbon tether. The compounds block Group IVA calcium dependent PLA2 (cPLA2) and / or Group VIA calcium independent PLA2 (iPLA2) and / or Group V secreted PLA2 (sPLA2).

The invention discloses an eimeria tenella gene, and more specifically discloses eimeria tenella calcium-dependent protein kinases 4 gene. The nucleotide sequence is disclosed in SEQ ID NO.1. The eimeria tenella calcium-dependent protein kinases 4 gene is a high expression gene at eimeria tenella spore period, is related to invading of sporozoite into host cells, and possesses relatively high application value in development of novel vaccines or novel drugs used for inhibiting invading of sporozoite into host cells and blocking eimeria tenella life history.

The present disclosure is directed to compositions and methods for inhibiting either Toxoplasma gondii (T. gondii) calcium dependent protein kinases (TgCDPKs) or Cryptosporidium parvum (C. parvum) and Cryptosporidium hominus (C. hominus) calcium dependent protein kinases (CpCDPKs) using pyrazolopyrimidine and / or imidazo[1,5-α]pyrazine inhibitors, of the Formula (I), wherein the variables X, Y, Z, R1, and R3 are defined herein.

A transgenic plant includes a first gene having a first polynucleotide and a recombinant construct having a second polynucleotide. The first polynucleotide is homologous to a Atclb gene fragment represented by nucleotide acids 963-1205 of SEQ ID NO:1. The first polynucleotide encodes a C2-like domain, and the Atclb gene fragment encodes a C2 domain represented by amino acids 265-345 of SEQ ID NO:2. The C2-like domain is homologous to the C2 domain. The second polynucleotide has at least 90% identity to the first polynucleotide or a sequence complimentary to the first polynucleotide. The recombinant construct is configured to silence the first gene such that the transgenic plant is tolerant to abiotic stress. A method to produce the transgenic plants.

The invention discloses a Chinese wild East China grape Baihe-35-1 calcium-dependent protein kinase gene VpCDPK13 and an application thereof. The invention relates to the field of gene engineering, inparticular to the field of grape disease-resistant breeding. The calcium-dependent protein kinase gene VpCDPK13 is separated from the disease-resistant Chinese wild East China grape Baihe-35-1 plantgenome through a gene cloning technology, and is transferred into a powdery mildew susceptible grape plant to obtain a powdery mildew resistant transgenic grape plant, so that the powdery mildew resistance of grapes is improved.

This invention provides a method for isolating and identifying proteins participating in protein-protein interactions in a complex mixture. The method uses a chemically reactive supporting matrix to isolate proteins that in turn non-covalently bind other proteins. The supporting matrix is isolated, and the non-covalently bound proteins are subsequently released for analysis. Because the proteins are accessible to chemical manipulation at both the binding and release steps, identification of the non-covalently bound proteins yields information on specific classes of interacting proteins, such as calcium-dependent or substrate-dependent protein interactions. This permits selection of a subpopulation of proteins from a complex mixture on the basis of specified interaction criteria. The method has the advantage of screening the entire proteome simultaneously, unlike two-hybrid systems or phage display methods which can only detect proteins binding to a single bait protein at a time. The method is applicable to the study of protein-protein interactions in biopsy and autopsy specimens, to the study of protein-protein interactions in the presence of signaling molecules, pharmacological agents or toxins, and for comparison of diseased and normal tissues or cancerous and untransformed cells.

The present invention provides methods for determining the structure and / or function of one or more domains of a cation-dependent (and preferably calcium-dependent) polypeptide (particularly a calcium-dependent enzyme, which may be a protease such as calpain) in the presence of one or more cations. The invention further provides methods for identifying a ligand having the ability to bind to one or more ligand-binding domains (LBDs) of a cation-dependent (and preferably calcium-dependent) polypeptide, and ligands identified by these methods. The invention also provides methods of treating or preventing physical disorders in animals using these ligands.

The present invention is based on two important experimental observations: The first observation is that increased extracellular concentrations of ionized calcium are found in erosive arthritis and stimulate monocytic IL-1β release via the CaSR and GPRC6A. Simultaneous stimulation of monocytes with calcium ions and selected TLR ligands results in a 20-fold increased IL1β response compared to lipopolysaccharide (LPS) alone. During the crosstalk between GPCR and TLR signaling, phospholipase C is activated, which triggers calcium dependent potassium channels, resulting in potassium efflux, caspase-1 activation and IL-1β release. The amplification of IL1β secretion at sites of locally increased calcium ion concentrations aggravates rheumatoid arthritis. The second important observation is that both CaSR and GPRC6A, are highly expressed in the synovial membrane of patients with rheumatoid arthritis, but expression of GPRC6A, but not of CaSR, is lower in patients with osteoarthritis (s. FIG. 1). The latter is generally not accompanied by inflammation. Thus, expression of GPRC6A appears to be upregulated in chronic inflammatory situations. Based on these experimental observations the invention provides a method and compositions for the identification of agents that have a potential effect against chronic inflammatory conditions, in particular erosive arthritis and atherosclerosis.

The invention provides a method for isolating and identifying proteins participating in protein-protein interactions in a complex mixture. The method uses a chemically reactive supporting matrix to isolate proteins that in turn non-covalently bind other proteins. The supporting matrix is isolated, and the non-covalently bound proteins are subsequently released for analysis. Because the proteins are accessible to chemical manipulation at both the binding and release steps, identification of the non-covalently bound proteins yields information on specific classes of interacting proteins, such as calcium-dependent or substrate-dependent protein interactions. This permits selection of a subpopulation of proteins from a complex mixture on the basis of specified interaction criteria. The method has the advantage of screening the entire proteome simultaneously, unlike two-hybrid systems or phage display methods which can only detect proteins binding to a single bait protein at a time. The method is applicable to the study of protein-protein interactions in biopsy and autopsy specimens, to the study of protein-protein interactions in the presence of signalling molecules, pharmacological agents or toxins, and for comparison of diseased and normal tissues or cancerous and untransformed cells.

Cystic fibrosis is developed through mutation of Cystic Fibrosis Transmembrane conductance Regulator (CFTR), which is one type of chloride channel. An object of the present invention is to provide compounds effective in the treatment of cystic fibrosis that open a chloride channel different from CFTR, which is the cause of the disease, and do not depend on CFTR.Compounds of the present invention are compounds or pharmaceutically acceptable salts thereof that open calcium dependent chloride channels (CaCCs) via G-protein coupled receptor 39 (GPR39) agonism to have strong chloride ion-secretory action, and are represented by the following general formula (I):General formula (I):wherein,X represents a carboxyl group or a tetrazolyl group;Q represents a C1-C3 alkylene group, an oxygen atom, a sulfur atom, etc.;G represents a phenyl group where the phenyl group may have 1 to 3 substituents independently selected from the group consisting of a halogen atom, a cyano group, a C1-C6 alkyl group, etc.;R1 represents a C1-C6 alkyl group, etc.;R2 represents a C1-C6 alkyl group that may have 1 to 3 substituents independently selected from the following group A, or a group selected from the following group B:Group A: a phenyl group and a pyridyl group, wherein the phenyl group and the pyridyl group may have 1 to 3 substituents independently selected from the following group D;Group B: —OH, —O-M, —SH, —S-M, —NH2, —NH-M, and —N-M2, wherein M is a C1-C6 alkyl group that may have 1 or 2 substituents independently selected from the following group C, or a C3-C6 cycloalkyl group that may have 1 or 2 substituents independently selected from the following group C;Group C: a halogen atom, a cyano group, a phenyl group, a pyridyl group, etc., wherein the phenyl group and the pyridyl group may have 1 to 3 substituents independently selected from the following group D; andGroup D: a halogen atom, a cyano group, a C1-C6 alkyl group, etc.