Patents
Literature
16 results about "Eimeria" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Eimeria is a genus of apicomplexan parasites that includes various species capable of causing the disease coccidiosis in animals such as cattle, poultry, and smaller ruminants including sheep and goats. Eimeria species are considered to be monoxenous because the life cycle is completed within a single host, and stenoxenous because they tend to be host specific, although a number of exceptions have been identified. Species of this genus infect a wide variety of hosts. Thirty-one species are known to occur in bats (Chiroptera), two in turtles, and 130 named species infect fish. Two species (E. phocae and E. weddelli) infect seals. Five species infect llamas and alpacas: E. alpacae, E. ivitaensis, E. lamae, E. macusaniensis, and E. punonensis. A number of species infect rodents, including E. couesii, E. kinsellai, E. palustris, E. ojastii and E. oryzomysi. Others infect poultry (E. necatrix and E. tenella), rabbits (E. stiedae) and cattle (E. bovis, E. ellipsoidalis, and E. zuernii). For full species list, see below.
Phytogenic additive and application thereof in promoting growth and combating coccidiosis and / or necrotic enteritis
The present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating a disease associated with protozoan parasite of the genus Eimeria, inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction, preventing or treating coccidiosis, promoting growth performance, controlling, treating and / or preventing necrotic enteritis in a subject, comprising administering to the subject an effective amount of a composition comprising a Crassocephalum rabens (CR), a bioactive extract thereof (CRE), an active ingredient(s) contained in a CR (CR_API) or CRE (CRE_API), a combination of two or more of a CR, a CRE, a CR_API and a CRE_API, or one or more of a-linolenic acid, citric acid, lactic acid, mannitol, palmitic acid, aspartic acid and 1-monomyristin.
Owner:ACAD SINICA +2
A nanobody specifically binding eimeria subspores and uses thereof
The application belongs to the technical field of biotechnology and veterinary medicine, and particularly relates to a nano-antibody specifically combined with Eimeria stiedai sporozoite and application thereof. The nano-antibody comprises an amino acid sequence shown in SEQ ID NO:1. Experiments show that the nano-antibody can be efficiently combined with Eimeria stiedai sporozoite, and significantly inhibit invasion of the sporozoite into rabbit intrahepatic bile duct epithelial cells. The nano-antibody provides a new type of efficient biological preparation candidate for preventing and controlling rabbit Eimeria stiedai disease, and has important diagnostic application value.
Owner:FUJIAN AGRI & FORESTRY UNIV +1
CPA kit, primers, applications and methods for detecting Eimeria coccidia and Cryptosporidium micrococcidia.
ActiveCN115948590BCoccidiaCryptosporidium ubiquitum
This invention relates to the field of biodetection technology, specifically disclosing a CPA kit, primers, applications, and methods for detecting Eimeria coccidia and Cryptosporidium micrococcidia. The CPA kit for detecting Eimeria coccidia and Cryptosporidium micrococcidia of this invention includes the primer combinations shown in SEQ ID No. 1-12. Using the method of this invention, high sensitivity and high specificity detection of Eimeria coccidia and Cryptosporidium micrococcidia can be achieved within 15-45 minutes.
Owner:JINYUBAOLING BIO PHARMA CO LTD
Preparation method and application of oral chicken infectious anemia vaccine
PendingCN121846258Asave human effortsave moneyAntibody mimetics/scaffoldsViral antigen ingredientsPoultry diseaseEimeria
The invention discloses a preparation method and application of an oral chicken infectious anemia vaccine. The preparation method comprises the following steps: providing an eimeria vector; genes of VP1 protein and VP2 protein for coding the chicken infectious anemia virus are introduced into the eimeria vector; after oral immunization, the recombinant eimeria can effectively reduce the clinical symptoms and virus load of chicken lean transmission, saves the manpower and material resources of vaccine immunization, is suitable for prevention and control of poultry epidemic diseases in large-scale breeding industry, and has a wide application prospect.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
A recombinant lactobacillus plantarum expressing anchoring eimeria tenella ron2 antigen and application thereof
The present application relates to a kind of recombinant plant lactobacillus expressing anchor Eimeria tenella RON2 antigen and application.The recombinant plant lactobacillus provided in the present application contains RON2-dendritic cell targeting peptide (DCpep) fusion protein transcription gene, which is composed of RON2 gene fragment and 3 DCpep gene fragments in series.The fusion protein has good immunogenicity, can be expressed on the surface of plant lactobacillus by pgsA' vector anchoring, and can be used to prepare oral vaccine.Compared with commercially available vaccine, the weight gain rate and anticoccidial index of the recombinant plant lactobacillus immune group of chicken are significantly increased, and the oocyst excretion and cecal lesion are significantly reduced.The above results confirm that the recombinant plant lactobacillus constructed in the present application, which targets dendritic cells and anchors Eimeria tenella RON2 antigen on the surface for oral administration, has good immunoprotective effect, and provides a new direction for the prevention and control of chicken Eimeria tenella disease in poultry breeding process.
Owner:JILIN AGRICULTURAL UNIV
Detection gene of Eimeria suis, fluorescent quantitative PCR (polymerase chain reaction) detection kit and preparation method
The invention relates to the technical field of biology, in particular to a detection gene of Eimeria suis, a fluorescent quantitative PCR (polymerase chain reaction) detection kit and a preparation method. According to the present invention, the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: AGCTAATTGGTACCTCTTCATACTGGTGGATTATTAATGCTATATGGGTGATCAGTCTTATACACAACACAA, and the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1; the kit prepared from the cox 1 gene and the SYAB Green fluorescent quantitative PCR detection reagent has the characteristics of high sensitivity, strong specificity and good repeatability when being used for detecting the Eimeria suis.
Owner:NORTHWEST A & F UNIV
Expression of eimeria sequences in plants and plant produced vaccine for same
Vaccines and methods of expressing a polypeptide of Eimeria are provided in which a protective response to Eimeria is produced when administered to an animal. The vaccine provides for expression of Eimeria vaccine proteins 3-1e, Gam82, and / or EF-1a polypeptide in a plant or plant part, linked to a promoter preferentially directing expression to embryo tissue of the plant or plant part. Further embodiments provide that the polypeptide may be targeted to the apoplast / cell wall or the endoplasmic reticulum. Increased expression levels in the plant or plant part are obtained. The plant or plant materials in an embodiment may be orally administered.
Owner:MAZEN ANIMAL HEALTH INC
Systems and methods of preparing and delivering oocyst solutions
The present disclosure provides systems and methods for disrupting the outer membrane of an oocyst in solution and delivering the solution to an animal. The system includes a vessel containing unbroken oocysts in solution, an oocyst processing chamber, and a delivery outlet. The unbroken oocysts are moved from the vessel through the processing chamber and a portion of the oocyst membranes are disrupted releasing sporocysts, the resulting solution is moved from the processing chamber into the delivery outlet where the solution is delivered to an animal. Methods of vaccination, including vaccination against an Eimeria infection, are also provided.
Owner:TARGAN INC
Berberine alkaloids in the prevention and / or treatment of intestinal disease
This invention relates to berberine alkaloids, formulations thereof and their use for the prevention and / or treatment of infectious disease, especially disease caused by C. perfringens and Eimeria in animals. The invention also relates to impoving the feed conversion ratio in a food producing animal by administering berberine compositions.
Owner:IRP HEALTH PTY LTD
Primer group for simultaneously detecting four types of horse digestive tract parasites and application of primer group
PendingCN121992111AMicrobiological testing/measurementMicroorganism based processesMultiplexNematode
The invention discloses a primer group for simultaneously detecting four types of horse alimentary canal parasites and application of the primer group. The primer group comprises primer sequences as shown in SEQ.ID.NO.1-8, and the four types of horse alimentary canal parasites are ascaris horse parasite, strongylus arvensis, giardia blue and eimeria. Extracting total DNA (deoxyribonucleic acid) of a sample to be detected by using the excrement sample nucleic acid extraction kit; the total DNA is used as a template, and the primer group is used for multiple PCR reaction to obtain an amplification curve. According to the invention, a primer sequence with high sensitivity and specificity is adopted, so that the quality of a detection result is ensured; the detection method is simple to operate, time-saving and labor-saving; the detection flux is high, and the reagent consumable cost is low.
Owner:NANJING ZHUOYI BIOTECHNOLOGY CO LTD
Kit for the discovery and application of lyso-phosphatidylcholine (lpc) with anticoccidial effect
The application provides a lysophosphatidylcholine (LPC) kit with anti-coccidiosis effect, and discloses a diagnosis marker for Eimeria tenella infected chicken, which is characteristic phospholipid and sphingolipid molecules, and specifically phosphatidylcholine (PC), lysophosphatidylcholine (LPC) and sphingomyelin (SM). Meanwhile, the application provides a medicine composition for improving the survival rate of chicks infected with Eimeria tenella, which is characterized by containing effective amounts of 18:2 LPA, 18:1 LPC, 22:0 LPC, 16:0 18:1 PC, 16:0 18:2 PC and d18:1 16:0 SM. The application screens characteristic phospholipid and sphingolipid molecules in the cecum tissue of chicken infected with Eimeria tenella for the first time, and verifies the curative effect of phosphatidylcholine (PC), lysophosphatidylcholine (LPC) and sphingomyelin (SM) on acute infection of chicks with Eimeria tenella, which has great market development prospect.
Owner:INST OF ANIMAL SCI & VETERINARY TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI +1
Five-plex real-time fluorescent quantitative PCR detection kit and detection method for simultaneous detection of five parasites
PCT designated stageWO2026085972A1Microbiological testing/measurementMicroorganism based processesNeospora speciesGondii toxoplasma
The present invention belongs to the technical field of biological detection. Provided are a five-plex real-time fluorescent quantitative PCR detection kit and a detection method for the simultaneous detection of five parasites. The method and the kit can be used for simultaneously detecting Toxoplasma gondii, Neospora caninum, Eimeria stiedai, Giardia lamblia and Trypanosoma evansi in the same system; and have the characteristics of qualitative and quantitative detection capability, high sensitivity, strong specificity, good repeatability and good stability.
Owner:NATIONAL INSTITUTES FOR FOOD & DRUG CONTROL (CENTER FOR MEDICAL DEVICE STANDARDIZATION ADMINISTRATION NMPA CHINA NATIONAL INSTITUTES FOR DRUG CONTROL)
A traditional Chinese medicine composition for treating chicken eimeria tenella and application thereof
ActiveCN117379500BHeavy metal active ingredientsAntiparasitic agentsVeterinary DrugsTherapeutic effect
The application belongs to the field of veterinary medicine preparation and discloses a traditional Chinese medicine composition for treating chicken Eimeria tenella and application thereof. The traditional Chinese medicine composition comprises the following components in parts by mass: mulberry leaves 14-16 parts, atractylodes 14-16 parts, agastache 8-12 parts, cinnabar 18-22 parts, areca nut 8-12 parts, milk root 18-22 parts, Chinese catalpa 8-12 parts, and licorice 5-7 parts. The traditional Chinese medicine composition has the effects of clearing heat and drying dampness, cooling blood and stopping diarrhea, and promoting qi and removing stagnation, has a good treatment effect on chicken coccidiosis, can improve the growth performance of chicks, and has no toxic side effects.
Owner:YANGZHOU UNIV
Method for improving gene editing efficiency of eimeria tenella, tool and application thereof
This invention provides a method, tool, and application for improving the gene editing efficiency of *Eimeria tenella*. The *Eimeria tenella* strain with KU80 deletion is obtained by knocking out the KU80 gene in *Eimeria tenella* using a CRISPR-Cas9 gene editing system. Compared with existing technologies, the tool and method of this invention can significantly improve gene-targeted integration efficiency, significantly reduce random integration events of exogenous DNA, and improve the accuracy and stability of gene editing. It is a universal gene editing platform that can be widely applied to gene knockout, gene knock-in, and endogenous marker research. The strain using this tool can significantly shorten the screening cycle for positive recombinant strains, improve experimental reproducibility, and provide important technical support for functional genomics research on *Eimeria tenella*.
Owner:SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
Protozoa aspartyl proteases and inhibitors for animal and human use
PCT designated stageWO2026111992A1Heterocyclic compound active ingredientsAgainst vector-borne diseasesProtozoaSpore
The present disclosure relates to methods of treating infections caused by one or more protozoa such as Cryptosporidium, Eimeria, Babesia and Toxoplasma comprising administering to a subject in need thereof an effective amount of an inhibitor of plasmepsin IX and / or X selected from compounds disclosed herein.
Owner:MERCK SHARP & DOHME LLC +2
Use of butyric acid-producing enterobacteriaceae as probiotic against eimeria tenella
The present application relates to the field of microbial technology, and particularly relates to the application of butyric acid-producing Enterobacter as an anti-Eimeria tenella probiotic. In the present application, the E. tenella infection model induced by an antibiotic cocktail is used to explore the effect of butyric acid-producing Enterobacter DSM 26588 on the development of E. tenella. The butyric acid-producing Enterobacter DSM 26588 inhibits the expression of the EtGFAT gene of the gamete of E. tenella, thereby inhibiting the development of the gamete; improves the intestinal lesions caused by E. tenella infection, reduces the pathological damage to the intestine, and reduces the output of E. tenella oocysts, with an ACI value of 162, and has good anti-coccidial effect.
Owner:JILIN AGRICULTURAL UNIV