Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

24 results about "Eimeria" patented technology

Eimeria is a genus of apicomplexan parasites that includes various species capable of causing the disease coccidiosis in animals such as cattle, poultry, and smaller ruminants including sheep and goats. Eimeria species are considered to be monoxenous because the life cycle is completed within a single host, and stenoxenous because they tend to be host specific, although a number of exceptions have been identified. Species of this genus infect a wide variety of hosts. Thirty-one species are known to occur in bats (Chiroptera), two in turtles, and 130 named species infect fish. Two species (E. phocae and E. weddelli) infect seals. Five species infect llamas and alpacas: E. alpacae, E. ivitaensis, E. lamae, E. macusaniensis, and E. punonensis. A number of species infect rodents, including E. couesii, E. kinsellai, E. palustris, E. ojastii and E. oryzomysi. Others infect poultry (E. necatrix and E. tenella), rabbits (E. stiedae) and cattle (E. bovis, E. ellipsoidalis, and E. zuernii). For full species list, see below.

Phytogenic additive and application thereof in promoting growth and combating coccidiosis and / or necrotic enteritis

PCT designated stageWO2026117596A1Digestive systemAnimal feeding stuffProtozoaDisease
The present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating a disease associated with protozoan parasite of the genus Eimeria, inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction, preventing or treating coccidiosis, promoting growth performance, controlling, treating and / or preventing necrotic enteritis in a subject, comprising administering to the subject an effective amount of a composition comprising a Crassocephalum rabens (CR), a bioactive extract thereof (CRE), an active ingredient(s) contained in a CR (CR_API) or CRE (CRE_API), a combination of two or more of a CR, a CRE, a CR_API and a CRE_API, or one or more of a-linolenic acid, citric acid, lactic acid, mannitol, palmitic acid, aspartic acid and 1-monomyristin.
Owner:ACAD SINICA +2

Apparatus for reducing eimeria tenella using microwaves

Provided is a device for reducing oocysts of Eimeria spp. using microwave, and more particularly to a device for reducing oocysts of Eimeria spp. using microwave in which when breeding broiler chickens, litter is recycled for second to fifth breeding after first breeding, and the hardened litter is crushed through a crushing device to form a floor similar to a first breeding environment and simultaneously microwaves of a microwave device are irradiated onto the crushed litter, so that various pathogenic organism such as oocysts of Eimeria spp., viruses, bacteria, parasites, and fungi in the litter are reduced or killed, and thus, pathogenicity and mortality become low, thereby healthily and safely breeding broiler chickens, and accordingly, providing great economic help to poultry farms.
Owner:HOXBIO CO LTD

A nanobody specifically binding eimeria subspores and uses thereof

The application belongs to the technical field of biotechnology and veterinary medicine, and particularly relates to a nano-antibody specifically combined with Eimeria stiedai sporozoite and application thereof. The nano-antibody comprises an amino acid sequence shown in SEQ ID NO:1. Experiments show that the nano-antibody can be efficiently combined with Eimeria stiedai sporozoite, and significantly inhibit invasion of the sporozoite into rabbit intrahepatic bile duct epithelial cells. The nano-antibody provides a new type of efficient biological preparation candidate for preventing and controlling rabbit Eimeria stiedai disease, and has important diagnostic application value.
Owner:FUJIAN AGRI & FORESTRY UNIV +1

Application of organic iron source in preparation of feed or medicine for relieving chicken eimeria tenella disease

The invention provides application of an organic iron source in preparation of feed or medicine for relieving chicken eimeria tenella disease, and relates to the technical field of feed additives and veterinary drugs. The organic iron source comprises one of a soybean protein iron chelate, a glycine iron complex and a methionine iron chelate. The feed or the medicine has at least one of the following functions: (1) the content of immune globulins IgA, IgG and IgM in chicken serum infected by eimeria tenella is increased; (2) reducing the expression level of the appendicular factors of the appendicular factors after the appendicular factors are infected by the eimeria tenella, wherein the appendicular factors of the appendicular factors comprise IL-1beta, IL-8, TNF-alpha and IFN-gamma; (3) the death rate of the chicken infected by eimeria tenella is reduced; (4) increasing the weight of the chicken infected by eimeria tenella; and (5) reducing the cecum lesion score of the chicken infected by the eimeria tenella.
Owner:HUNAN AGRI UNIV +1

Eimeria gene editing system, recombinant coccidiosis vector and application of recombinant coccidiosis vector

PendingCN121046376AProtozoaMicroorganism based processesCoccidiosisEimeria
The invention discloses an eimeria gene editing system, a recombinant coccidium vector and application of the recombinant coccidium vector. The invention firstly provides the sgRNA targeting the ETH00010755 gene and the gene editing system containing the sgRNA, and the sgRNA and the gene editing system can realize high-efficiency and high-specificity gene editing. A donor plasmid template containing His4 and EtU6 promoters is constructed, compared with an original plasmid template, the donor plasmid template has the advantages that the positive rate is higher, an exogenous gene can be accurately inserted into an ETH00010755 gene, the unspecific gene editing risk can be avoided through the gene editing plasmid, and the high editing efficiency and the low off-target rate are achieved. The gene editing system, the recombinant coccidiosis vector and the construction method of the recombinant coccidiosis vector are mature, reliable and easy to operate and have high success rate and repeatability, and the obtained recombinant coccidiosis vector can be applied to preparation of immune drugs and / or vaccines for preventing eimeria.
Owner:SOUTH CHINA AGRICULTURAL UNIVERSITY

CPA kit, primers, applications and methods for detecting Eimeria coccidia and Cryptosporidium micrococcidia.

ActiveCN115948590BCoccidiaCryptosporidium ubiquitum
This invention relates to the field of biodetection technology, specifically disclosing a CPA kit, primers, applications, and methods for detecting Eimeria coccidia and Cryptosporidium micrococcidia. The CPA kit for detecting Eimeria coccidia and Cryptosporidium micrococcidia of this invention includes the primer combinations shown in SEQ ID No. 1-12. Using the method of this invention, high sensitivity and high specificity detection of Eimeria coccidia and Cryptosporidium micrococcidia can be achieved within 15-45 minutes.
Owner:JINYUBAOLING BIO PHARMA CO LTD

Preparation method and application of oral chicken infectious anemia vaccine

The invention discloses a preparation method and application of an oral chicken infectious anemia vaccine. The preparation method comprises the following steps: providing an eimeria vector; genes of VP1 protein and VP2 protein for coding the chicken infectious anemia virus are introduced into the eimeria vector; after oral immunization, the recombinant eimeria can effectively reduce the clinical symptoms and virus load of chicken lean transmission, saves the manpower and material resources of vaccine immunization, is suitable for prevention and control of poultry epidemic diseases in large-scale breeding industry, and has a wide application prospect.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

A traditional Chinese medicine composition and its application in the preparation of a drug for preventing Eimeria tenella coccidiosis in chickens and improving the growth performance of chicks.

This invention belongs to the field of veterinary drug preparation and discloses a traditional Chinese medicine composition and its application in the preparation of drugs for preventing Eimeria tenella and improving the growth performance of chicks. The traditional Chinese medicine composition comprises the following components in parts by weight: 8-12 parts of Costus root, 8-12 parts of white hyacinth bean, 4-8 parts of immature bitter orange, 4-8 parts of peony root, 8-12 parts of milkweed root, 4-8 parts of cinnamon twig, 12-18 parts of astragalus root, 4-8 parts of ginger, and 4-8 parts of licorice root. This traditional Chinese medicine composition has the effects of warming yang and dispelling cold, strengthening the spleen and promoting diuresis, and regulating qi and relieving stagnation. It has a good preventive effect on Eimeria tenella and can improve the growth performance of chicks, without toxic side effects.
Owner:YANGZHOU UNIV

A recombinant lactobacillus plantarum expressing anchoring eimeria tenella ron2 antigen and application thereof

The present application relates to a kind of recombinant plant lactobacillus expressing anchor Eimeria tenella RON2 antigen and application.The recombinant plant lactobacillus provided in the present application contains RON2-dendritic cell targeting peptide (DCpep) fusion protein transcription gene, which is composed of RON2 gene fragment and 3 DCpep gene fragments in series.The fusion protein has good immunogenicity, can be expressed on the surface of plant lactobacillus by pgsA' vector anchoring, and can be used to prepare oral vaccine.Compared with commercially available vaccine, the weight gain rate and anticoccidial index of the recombinant plant lactobacillus immune group of chicken are significantly increased, and the oocyst excretion and cecal lesion are significantly reduced.The above results confirm that the recombinant plant lactobacillus constructed in the present application, which targets dendritic cells and anchors Eimeria tenella RON2 antigen on the surface for oral administration, has good immunoprotective effect, and provides a new direction for the prevention and control of chicken Eimeria tenella disease in poultry breeding process.
Owner:JILIN AGRICULTURAL UNIV

Detection gene of Eimeria suis, fluorescent quantitative PCR (polymerase chain reaction) detection kit and preparation method

The invention relates to the technical field of biology, in particular to a detection gene of Eimeria suis, a fluorescent quantitative PCR (polymerase chain reaction) detection kit and a preparation method. According to the present invention, the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: AGCTAATTGGTACCTCTTCATACTGGTGGATTATTAATGCTATATGGGTGATCAGTCTTATACACAACACAA, and the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1; the kit prepared from the cox 1 gene and the SYAB Green fluorescent quantitative PCR detection reagent has the characteristics of high sensitivity, strong specificity and good repeatability when being used for detecting the Eimeria suis.
Owner:NORTHWEST A & F UNIV

Expression of eimeria sequences in plants and plant produced vaccine for same

Vaccines and methods of expressing a polypeptide of Eimeria are provided in which a protective response to Eimeria is produced when administered to an animal. The vaccine provides for expression of Eimeria vaccine proteins 3-1e, Gam82, and / or EF-1a polypeptide in a plant or plant part, linked to a promoter preferentially directing expression to embryo tissue of the plant or plant part. Further embodiments provide that the polypeptide may be targeted to the apoplast / cell wall or the endoplasmic reticulum. Increased expression levels in the plant or plant part are obtained. The plant or plant materials in an embodiment may be orally administered.
Owner:MAZEN ANIMAL HEALTH INC

Preparation method and identification method for N-myristic acylation of eimeria tenella

The invention belongs to the technical field of biochemistry, and particularly relates to a preparation method and an identification method for N-myristic acylation of eimeria tenella. The invention aims to provide a method for analyzing the N-myristic acylation omics of eimeria tenella by adopting a bio-orthogonal click chemistry method, so as to solve the problem that the research on an analysis mechanism of the N-myristic acylation omics of eimeria tenella is incomplete. And a theoretical basis and a practical basis are provided for developing N-myristic acylation of eimeria tenella.
Owner:LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)

A plant-derived composition for preventing and treating chicken coccidiosis

The application discloses a plant source composition which is composed of eucalyptus leaf essential oil, eugenol essential oil and apigenin, and discloses a preparation method of the composition and application of the composition in resisting chicken coccidiosis, and belongs to the field of disease prevention and treatment of poultry and livestock and feed additive. The composition can resist Eimeria tenella, and has a promoting effect on the growth performance of chickens, is a new type of feed additive with small toxic and side effects and good insecticidal effect, has low production cost and good stability, and has great application prospect in the aspect of coccidiosis resistance of poultry.
Owner:HUAZHONG AGRI UNIV

Systems and methods of preparing and delivering oocyst solutions

The present disclosure provides systems and methods for disrupting the outer membrane of an oocyst in solution and delivering the solution to an animal. The system includes a vessel containing unbroken oocysts in solution, an oocyst processing chamber, and a delivery outlet. The unbroken oocysts are moved from the vessel through the processing chamber and a portion of the oocyst membranes are disrupted releasing sporocysts, the resulting solution is moved from the processing chamber into the delivery outlet where the solution is delivered to an animal. Methods of vaccination, including vaccination against an Eimeria infection, are also provided.
Owner:TARGAN INC

Berberine alkaloids in the prevention and / or treatment of intestinal disease

ActiveCA3057858CBerberine AlkaloidsBerberine
This invention relates to berberine alkaloids, formulations thereof and their use for the prevention and / or treatment of infectious disease, especially disease caused by C. perfringens and Eimeria in animals. The invention also relates to impoving the feed conversion ratio in a food producing animal by administering berberine compositions.
Owner:IRP HEALTH PTY LTD

Kit for finding and applying lysophosphatidylcholine (LPC) with anti-coccidiosis effect

The invention provides a kit for finding and applying lysophosphatidylcholine (LPC) with an anti-coccidiosis effect, and particularly discloses a diagnostic marker for eimeria tenella infected chicken, the marker comprises characteristic phospholipid and sphingolipid molecules, and the marker specifically comprises phosphatidylcholine (PC), lysophosphatidylcholine (LPC) and sphingomyelin (SM). Meanwhile, the invention provides a pharmaceutical composition for improving the survival rate of chicks infected with eimeria tenella, and the pharmaceutical composition is characterized in that the pharmaceutical composition contains effective amounts of 18: 2LPA, 18: 1LPC, 22: 0LPC, 16: 018: 1PC, 16: 018: 2PC and d18: 1 16: 0SM. The specific phospholipid and sphingolipid molecules in the chicken cecum tissue infected by the eimeria tenella are screened for the first time, the curative effect of phosphatidylcholine (PC), lysophosphatidylcholine (LPC) and sphingomyelin (SM) on the acute infection of the eimeria tenella in the chicken is verified, and the specific phospholipid and sphingolipid molecules have a great market development prospect.
Owner:INST OF ANIMAL SCI & VETERINARY TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI +1

Primer group for simultaneously detecting four types of horse digestive tract parasites and application of primer group

The invention discloses a primer group for simultaneously detecting four types of horse alimentary canal parasites and application of the primer group. The primer group comprises primer sequences as shown in SEQ.ID.NO.1-8, and the four types of horse alimentary canal parasites are ascaris horse parasite, strongylus arvensis, giardia blue and eimeria. Extracting total DNA (deoxyribonucleic acid) of a sample to be detected by using the excrement sample nucleic acid extraction kit; the total DNA is used as a template, and the primer group is used for multiple PCR reaction to obtain an amplification curve. According to the invention, a primer sequence with high sensitivity and specificity is adopted, so that the quality of a detection result is ensured; the detection method is simple to operate, time-saving and labor-saving; the detection flux is high, and the reagent consumable cost is low.
Owner:NANJING ZHUOYI BIOTECHNOLOGY CO LTD

CPA primer group and kit for detecting seven chicken eimeria coccidiosis and application of CPA primer group and kit

The invention discloses a CPA primer group and a kit for detecting seven chicken eimeria coccidiosis and application of the CPA primer group and the kit, and belongs to the technical field of biological detection. Specific primers are designed for conservative COI genes of chicken eimeria, an optimal reaction system and 61 DEG C constant-temperature amplification conditions are optimized and determined, and a CPA detection method for detecting chicken eimeria is established. The method is extremely high in sensitivity, the lower limit of detection on a plasmid standard substance reaches 102 copies / L, extremely low pathogen load equivalent to 0.5 oocyst can be stably detected in practical application, the clinical sample verification coincidence rate reaches 100%, and a powerful technical support is provided for early warning, field monitoring and precise prevention and control of chicken coccidiosis.
Owner:SHANXI AGRI UNIV

Kit for the discovery and application of lyso-phosphatidylcholine (lpc) with anticoccidial effect

ActiveCN120847277BCurative effectEimeria
The application provides a lysophosphatidylcholine (LPC) kit with anti-coccidiosis effect, and discloses a diagnosis marker for Eimeria tenella infected chicken, which is characteristic phospholipid and sphingolipid molecules, and specifically phosphatidylcholine (PC), lysophosphatidylcholine (LPC) and sphingomyelin (SM). Meanwhile, the application provides a medicine composition for improving the survival rate of chicks infected with Eimeria tenella, which is characterized by containing effective amounts of 18:2 LPA, 18:1 LPC, 22:0 LPC, 16:0 18:1 PC, 16:0 18:2 PC and d18:1 16:0 SM. The application screens characteristic phospholipid and sphingolipid molecules in the cecum tissue of chicken infected with Eimeria tenella for the first time, and verifies the curative effect of phosphatidylcholine (PC), lysophosphatidylcholine (LPC) and sphingomyelin (SM) on acute infection of chicks with Eimeria tenella, which has great market development prospect.
Owner:INST OF ANIMAL SCI & VETERINARY TIBET ACADEMY OF AGRI & ANIMAL HUSBANDRY SCI +1

Five-plex real-time fluorescent quantitative PCR detection kit and detection method for simultaneous detection of five parasites

Owner:NATIONAL INSTITUTES FOR FOOD & DRUG CONTROL (CENTER FOR MEDICAL DEVICE STANDARDIZATION ADMINISTRATION NMPA CHINA NATIONAL INSTITUTES FOR DRUG CONTROL)

A traditional Chinese medicine composition for treating chicken eimeria tenella and application thereof

The application belongs to the field of veterinary medicine preparation and discloses a traditional Chinese medicine composition for treating chicken Eimeria tenella and application thereof. The traditional Chinese medicine composition comprises the following components in parts by mass: mulberry leaves 14-16 parts, atractylodes 14-16 parts, agastache 8-12 parts, cinnabar 18-22 parts, areca nut 8-12 parts, milk root 18-22 parts, Chinese catalpa 8-12 parts, and licorice 5-7 parts. The traditional Chinese medicine composition has the effects of clearing heat and drying dampness, cooling blood and stopping diarrhea, and promoting qi and removing stagnation, has a good treatment effect on chicken coccidiosis, can improve the growth performance of chicks, and has no toxic side effects.
Owner:YANGZHOU UNIV

Method for improving gene editing efficiency of eimeria tenella, tool and application thereof

PendingCN122128340AProtozoaMicroorganism based processesExogenous DNAEimeria
This invention provides a method, tool, and application for improving the gene editing efficiency of *Eimeria tenella*. The *Eimeria tenella* strain with KU80 deletion is obtained by knocking out the KU80 gene in *Eimeria tenella* using a CRISPR-Cas9 gene editing system. Compared with existing technologies, the tool and method of this invention can significantly improve gene-targeted integration efficiency, significantly reduce random integration events of exogenous DNA, and improve the accuracy and stability of gene editing. It is a universal gene editing platform that can be widely applied to gene knockout, gene knock-in, and endogenous marker research. The strain using this tool can significantly shorten the screening cycle for positive recombinant strains, improve experimental reproducibility, and provide important technical support for functional genomics research on *Eimeria tenella*.
Owner:SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)

Protozoa aspartyl proteases and inhibitors for animal and human use

The present disclosure relates to methods of treating infections caused by one or more protozoa such as Cryptosporidium, Eimeria, Babesia and Toxoplasma comprising administering to a subject in need thereof an effective amount of an inhibitor of plasmepsin IX and / or X selected from compounds disclosed herein.
Owner:MERCK SHARP & DOHME LLC +2

Use of butyric acid-producing enterobacteriaceae as probiotic against eimeria tenella

The present application relates to the field of microbial technology, and particularly relates to the application of butyric acid-producing Enterobacter as an anti-Eimeria tenella probiotic. In the present application, the E. tenella infection model induced by an antibiotic cocktail is used to explore the effect of butyric acid-producing Enterobacter DSM 26588 on the development of E. tenella. The butyric acid-producing Enterobacter DSM 26588 inhibits the expression of the EtGFAT gene of the gamete of E. tenella, thereby inhibiting the development of the gamete; improves the intestinal lesions caused by E. tenella infection, reduces the pathological damage to the intestine, and reduces the output of E. tenella oocysts, with an ACI value of 162, and has good anti-coccidial effect.
Owner:JILIN AGRICULTURAL UNIV