42 results about "Eimeria" patented technology

The invention relates to the technical field of microorganisms, in particular to application of butyric acid producing enterobacter as a probiotic for resisting eimeria tenella. In the invention, an antibiotic cocktail-induced eimeria tenella infection model is utilized to explore the effect of butyric acid-producing enterobacter DSM 26588 on eimeria tenella development. The enterobacter butyricum DSM 26588 inhibits the growth of gametes by inhibiting the expression of the eimeria tenella gamete EtGFAT gene; according to the present invention, the intestinal tract lesion caused by Eimeria tenella infection can be improved, the intestinal tract pathological injury can be alleviated so as to reduce the Eimeria tenella oocyst discharge amount, the ACI value is 162, and the good anti-coccidiosis effect can be provided.

The present invention provides a method for detecting the viability of chicken coccidian oocysts, comprising the following steps: respectively obtaining the sporozoite escape rate of a chicken coccidian oocyst sample to be tested and the sporozoite escape rate of a control chicken coccidian oocyst sample, analyzing the sporozoite escape rate and the sporozoite escape rate, and detecting the viability of the chicken coccidian oocyst sample to be tested according to the obtained analysis result. The present invention is suitable for detecting the viability of chicken coccidian oocysts and chicken coccidian oocyst vaccines, has simple operation and high repeatability, and is applicable to clinical production and laboratory promotion and detection.

The present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating a disease associated with protozoan parasite of the genus Eimeria, inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction, preventing or treating coccidiosis, promoting growth performance, controlling, treating and / or preventing necrotic enteritis in a subject, comprising administering to the subject an effective amount of a composition comprising a Crassocephalum rabens (CR), a bioactive extract thereof (CRE), an active ingredient(s) contained in a CR (CR_API) or CRE (CRE_API), a combination of two or more of a CR, a CRE, a CR_API and a CRE_API, or one or more of a-linolenic acid, citric acid, lactic acid, mannitol, palmitic acid, aspartic acid and 1-monomyristin.

Provided is a device for reducing oocysts of Eimeria spp. using microwave, and more particularly to a device for reducing oocysts of Eimeria spp. using microwave in which when breeding broiler chickens, litter is recycled for second to fifth breeding after first breeding, and the hardened litter is crushed through a crushing device to form a floor similar to a first breeding environment and simultaneously microwaves of a microwave device are irradiated onto the crushed litter, so that various pathogenic organism such as oocysts of Eimeria spp., viruses, bacteria, parasites, and fungi in the litter are reduced or killed, and thus, pathogenicity and mortality become low, thereby healthily and safely breeding broiler chickens, and accordingly, providing great economic help to poultry farms.

The invention discloses application of dicoumarin to resistance to eimeria infection, and belongs to the technical field of application of dicoumarin. The invention not only discloses that the biscoumarin can effectively inhibit the reproduction of the eimeria on an in-vitro eimeria cell culture model, but also discloses application of the biscoumarin in preparation of the eimeria infection resisting medicine or feed. According to the application, research finds that dicoumarin has an obvious inhibition effect on eimeria for the first time, the effect can be observed on an in-vitro eimeria cell culture model, and an in-vivo infection model of an animal with chicken infected with eimeria is verified. The application of the dicoumarin to the field of parasitic infection resistance is beneficial to expanding the medicinal value of the dicoumarin.

The invention provides application of gossypol in preparation of chicken feed or medicine for preventing and treating chicken coccidiosis, and relates to the technical field of parasitic disease prevention and treatment. Experimental exploration proves that gossypol has a new application of preventing and treating chicken coccidiosis, a new scheme is provided for development of drugs and feeds for preventing and treating chicken coccidiosis, a new idea is provided for clinical control of chicken coccidiosis, and the application range of gossypol is expanded. Gossypol acts on chicks infected with chicken eimeria tenella disease, compared with chicks in a challenge control group, the reduction rate of oocyst discharge of chicks in a gossypol treatment group reaches 82.5%, the relative weight gain rate can reach 90.8%, the coccidiosis resistance index of the chicks can reach 167.4, and bleeding symptoms caused by chicken coccidiosis can be effectively reduced.

The application belongs to the technical field of biotechnology and veterinary medicine, and particularly relates to a nano-antibody specifically combined with Eimeria stiedai sporozoite and application thereof. The nano-antibody comprises an amino acid sequence shown in SEQ ID NO:1. Experiments show that the nano-antibody can be efficiently combined with Eimeria stiedai sporozoite, and significantly inhibit invasion of the sporozoite into rabbit intrahepatic bile duct epithelial cells. The nano-antibody provides a new type of efficient biological preparation candidate for preventing and controlling rabbit Eimeria stiedai disease, and has important diagnostic application value.

The invention discloses application of gga-miR-7b in relieving chicken eimeria tenella infection. The nucleotide sequence of the gga-miR-7b is shown as SEQ ID NO. 1. The invention also discloses application of the gga-miR-7b in relieving chicken eimeria tenella infection. The invention further discloses a specific primer for detecting the expression quantity of the miRNA capable of relieving chicken eimeria tenella infection. The invention also discloses a detection kit. The invention also discloses application of the miRNA, the specific primer and the detection kit in researching or regulating and controlling the inflammatory injury regulation effect of a chicken coccidiosis infected host. The detection kit provided by the invention can be used for detecting the expression quantity of the gga-miR-7b in the chicken cecum tissue, and the detection method is simple and rapid. According to the invention, the expression quantity of the gga-miR-7b can be used for relieving the inflammatory injury caused by chicken eimeria tenella infection, the method comprises the step of improving the expression quantity of the gga-miR-7b, and a novel molecular intervention method is provided for diagnosing and treating chicken coccidiosis.

A composition, an in ovo vaccine, and a composition for use as a vaccine against coccidiosis. The compositions and vaccine include Eimeria oocysts from a precocious attenuated strain of E. acervulina, and from at least one precocious attenuated strain selected from E. maxima, E. praecox and E. tenella. The composition and vaccine can be administered in ovo to embryonated eggs of a domesticated bird. A combination vaccine for use in the prevention and / or treatment of an Eimeria infection and Infectious Bursal Disease (Gumboro disease) and a kit for use as a vaccine including the composition.

The invention provides application of an organic iron source in preparation of feed or medicine for relieving chicken eimeria tenella disease, and relates to the technical field of feed additives and veterinary drugs. The organic iron source comprises one of a soybean protein iron chelate, a glycine iron complex and a methionine iron chelate. The feed or the medicine has at least one of the following functions: (1) the content of immune globulins IgA, IgG and IgM in chicken serum infected by eimeria tenella is increased; (2) reducing the expression level of the appendicular factors of the appendicular factors after the appendicular factors are infected by the eimeria tenella, wherein the appendicular factors of the appendicular factors comprise IL-1beta, IL-8, TNF-alpha and IFN-gamma; (3) the death rate of the chicken infected by eimeria tenella is reduced; (4) increasing the weight of the chicken infected by eimeria tenella; and (5) reducing the cecum lesion score of the chicken infected by the eimeria tenella.

The invention discloses an eimeria gene editing system, a recombinant coccidium vector and application of the recombinant coccidium vector. The invention firstly provides the sgRNA targeting the ETH00010755 gene and the gene editing system containing the sgRNA, and the sgRNA and the gene editing system can realize high-efficiency and high-specificity gene editing. A donor plasmid template containing His4 and EtU6 promoters is constructed, compared with an original plasmid template, the donor plasmid template has the advantages that the positive rate is higher, an exogenous gene can be accurately inserted into an ETH00010755 gene, the unspecific gene editing risk can be avoided through the gene editing plasmid, and the high editing efficiency and the low off-target rate are achieved. The gene editing system, the recombinant coccidiosis vector and the construction method of the recombinant coccidiosis vector are mature, reliable and easy to operate and have high success rate and repeatability, and the obtained recombinant coccidiosis vector can be applied to preparation of immune drugs and / or vaccines for preventing eimeria.

This invention relates to the field of biodetection technology, specifically disclosing a CPA kit, primers, applications, and methods for detecting Eimeria coccidia and Cryptosporidium micrococcidia. The CPA kit for detecting Eimeria coccidia and Cryptosporidium micrococcidia of this invention includes the primer combinations shown in SEQ ID No. 1-12. Using the method of this invention, high sensitivity and high specificity detection of Eimeria coccidia and Cryptosporidium micrococcidia can be achieved within 15-45 minutes.

The invention discloses a preparation method and application of an oral chicken infectious anemia vaccine. The preparation method comprises the following steps: providing an eimeria vector; genes of VP1 protein and VP2 protein for coding the chicken infectious anemia virus are introduced into the eimeria vector; after oral immunization, the recombinant eimeria can effectively reduce the clinical symptoms and virus load of chicken lean transmission, saves the manpower and material resources of vaccine immunization, is suitable for prevention and control of poultry epidemic diseases in large-scale breeding industry, and has a wide application prospect.

This invention belongs to the field of veterinary drug preparation and discloses a traditional Chinese medicine composition and its application in the preparation of drugs for preventing Eimeria tenella and improving the growth performance of chicks. The traditional Chinese medicine composition comprises the following components in parts by weight: 8-12 parts of Costus root, 8-12 parts of white hyacinth bean, 4-8 parts of immature bitter orange, 4-8 parts of peony root, 8-12 parts of milkweed root, 4-8 parts of cinnamon twig, 12-18 parts of astragalus root, 4-8 parts of ginger, and 4-8 parts of licorice root. This traditional Chinese medicine composition has the effects of warming yang and dispelling cold, strengthening the spleen and promoting diuresis, and regulating qi and relieving stagnation. It has a good preventive effect on Eimeria tenella and can improve the growth performance of chicks, without toxic side effects.

According to the ferritin nanoparticle vaccine for preventing rabbit eimeria stigganii disease and the preparation method, ferritin nanoparticles are adopted as a carrier of the vaccine to prepare the vaccine for preventing eimeria stigganii disease subunits, and the stability and immunogenicity of the vaccine are greatly improved; targeted delivery of vaccines is achieved through the nanotechnology, the vaccines can act on immune cells more accurately, the immune response level is improved, and the method has the advantages of being low in cost, high in safety, good in protection effect and the like.

Compounds capable of selectively modulating the TLR signaling pathway provide an improved treatment method for a broad variety of diseases in both animals and humans. The mechanisms of action in the treatment and / or prevention of coccidiosis and other conditions related to gut inflammation are via a direct effect on innate and adaptive immune pathways. The downstream results are improvements in performance parameters related to gut health (including altering gut microbes, conversion rates, and body weight gains among others. When administered to animals, the bioactives of the disclosed inventive compound mitigate the effects of coccidiosis via an enhanced immune response rather than a direct effect on parasites, such as the Eimeria parasite. The mechanisms of action of the disclosed inventive compound and method are via immune system priming rather than a direct effect on pathogens, thus there is no risk of treatment resistance being developed.

The invention discloses a purification method of Eimeria stigganii sporozoites, which comprises the following steps: carrying out dissection detection to obtain lesion rabbit livers, and obtaining Eimeria stigganii oocysts; carrying out sporulation treatment to obtain a potassium dichromate sporulation oocyst suspension; adding sodium hypochlorite into the precipitate, and blowing and beating on ice; taking upper-layer floating foam and liquid after centrifugation, adding clear water, and centrifuging to obtain clean sporulated oocysts; adding glass beads for grinding and carrying out oscillation treatment; carrying out primary centrifugation, absorbing supernatant liquid, adding 50% percol liquid, and carrying out secondary centrifugation; adding a decapsulation buffer solution into the precipitate, and carrying out water bath digestion treatment for a certain time; and carrying out primary centrifugation on the digested suspension, taking the precipitate, adding a 55% percol solution, carrying out secondary centrifugation, taking the precipitate, diluting, fixing the volume, and naturally filtering to obtain the clean Eimeria stigmas sporozoites. The method has the remarkable effects of simplicity in operation, low cost, high sporozoite yield and time saving in the purification process.

The present application relates to a kind of recombinant plant lactobacillus expressing anchor Eimeria tenella RON2 antigen and application.The recombinant plant lactobacillus provided in the present application contains RON2-dendritic cell targeting peptide (DCpep) fusion protein transcription gene, which is composed of RON2 gene fragment and 3 DCpep gene fragments in series.The fusion protein has good immunogenicity, can be expressed on the surface of plant lactobacillus by pgsA' vector anchoring, and can be used to prepare oral vaccine.Compared with commercially available vaccine, the weight gain rate and anticoccidial index of the recombinant plant lactobacillus immune group of chicken are significantly increased, and the oocyst excretion and cecal lesion are significantly reduced.The above results confirm that the recombinant plant lactobacillus constructed in the present application, which targets dendritic cells and anchors Eimeria tenella RON2 antigen on the surface for oral administration, has good immunoprotective effect, and provides a new direction for the prevention and control of chicken Eimeria tenella disease in poultry breeding process.

The invention relates to the technical field of biology, in particular to a detection gene of Eimeria suis, a fluorescent quantitative PCR (polymerase chain reaction) detection kit and a preparation method. According to the present invention, the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: AGCTAATTGGTACCTCTTCATACTGGTGGATTATTAATGCTATATGGGTGATCAGTCTTATACACAACACAA, and the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis provided by the invention is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1 of the Eimeria suis coccidiosis is as follows: the conserved sequence of the detection gene cox 1; the kit prepared from the cox 1 gene and the SYAB Green fluorescent quantitative PCR detection reagent has the characteristics of high sensitivity, strong specificity and good repeatability when being used for detecting the Eimeria suis.

Provided is a device for reducing oocysts of Eimeria spp. using microwave, and more particularly to a device for reducing oocysts of Eimeria spp. using microwave in which when breeding broiler chickens, litter is recycled for second to fifth breeding after first breeding, and the hardened litter is crushed through a crushing device to form a floor similar to a first breeding environment and simultaneously microwaves of a microwave device are irradiated onto the crushed litter, so that various pathogenic organism such as oocysts of Eimeria spp., viruses, bacteria, parasites, and fungi in the litter are reduced or killed, and thus, pathogenicity and mortality become low, thereby healthily and safely breeding broiler chickens, and accordingly, providing great economic help to poultry farms.

The present invention relates to the field of genetic engineering technology, and specifically provides a site for the site-specific integration of exogenous genes in Eimeria tenella and its application. The present invention relates to the screening of a site-specific integration of exogenous genes in transgenic Eimeria tenella, plasmid construction and its application. The present invention discloses information on an efficient integration site for Eimeria tenella, and after the exogenous gene is integrated into the site, it can not only be stably inherited but also improve the reproductive capacity of the transgenic coccidia to a certain extent. The present invention also provides a plasmid vector, comprising: a homologous left arm of the site-specific integration site, an exogenous gene and a homologous right arm of the site-specific integration site. The vector is designed based on the CRISPR / Cas9 targeting system, and the plasmid vector can accurately introduce the exogenous gene into a specific site in the coccidia genome, thereby solving the problems of random integration of exogenous genes in coccidia transgenic technology and loss of exogenous genes in transgenic coccidia.

Vaccines and methods of expressing a polypeptide of Eimeria are provided in which a protective response to Eimeria is produced when administered to an animal. The vaccine provides for expression of Eimeria vaccine proteins 3-1e, Gam82, and / or EF-1a polypeptide in a plant or plant part, linked to a promoter preferentially directing expression to embryo tissue of the plant or plant part. Further embodiments provide that the polypeptide may be targeted to the apoplast / cell wall or the endoplasmic reticulum. Increased expression levels in the plant or plant part are obtained. The plant or plant materials in an embodiment may be orally administered.

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to drug resistance of eimeria maduramicin and application of the SNP molecular marker. The method comprises the following steps: hybridizing a chicken eimeria tenella maduramicin drug-resistant strain with a sensitive strain, and backcrossing the hybridized strain with the sensitive strain to construct a maduramicin drug-resistant introgression line strain. By means of a genome re-sequencing technology and a gene editing technology, polymorphic mutation exists in the 1255th nucleotide of the ETH20402100 gene, C corresponds to a maduramicin sensitive phenotype, and T corresponds to a maduramicin drug-resistant phenotype. Based on a PCR identification result of a field sample, the SNP molecular marker can accurately detect the drug resistance of maduramicin, and the result is consistent with a cage feeding experiment. The invention provides a primer for detection and a method for screening drug-resistant strains by combining a PCR (Polymerase Chain Reaction) technology, and the method is simple to operate, short in time consumption and low in cost, and can be widely applied to clinical detection of the drug resistance of chicken coccidiosis maduramicin and drug use guidance.

The invention belongs to the technical field of biochemistry, and particularly relates to a preparation method and an identification method for N-myristic acylation of eimeria tenella. The invention aims to provide a method for analyzing the N-myristic acylation omics of eimeria tenella by adopting a bio-orthogonal click chemistry method, so as to solve the problem that the research on an analysis mechanism of the N-myristic acylation omics of eimeria tenella is incomplete. And a theoretical basis and a practical basis are provided for developing N-myristic acylation of eimeria tenella.

The application discloses a plant source composition which is composed of eucalyptus leaf essential oil, eugenol essential oil and apigenin, and discloses a preparation method of the composition and application of the composition in resisting chicken coccidiosis, and belongs to the field of disease prevention and treatment of poultry and livestock and feed additive. The composition can resist Eimeria tenella, and has a promoting effect on the growth performance of chickens, is a new type of feed additive with small toxic and side effects and good insecticidal effect, has low production cost and good stability, and has great application prospect in the aspect of coccidiosis resistance of poultry.

The invention belongs to the technical field of biological detection, and particularly relates to a CPA primer and a kit for detecting chicken eimeria tenella and application of the CPA primer and the kit. Specific isothermal amplification primers are designed aiming at chicken eimeria tenella genes, target fragments are amplified by utilizing the isothermal amplification primers, and then a lateral flow chromatography test strip is connected to visualize results. The method is easy to operate, high in sensitivity and good in specificity, detection can be completed only through constant-temperature heating equipment, and a new technology and method are provided for detecting chicken eimeria tenella.

The present disclosure provides systems and methods for disrupting the outer membrane of an oocyst in solution and delivering the solution to an animal. The system includes a vessel containing unbroken oocysts in solution, an oocyst processing chamber, and a delivery outlet. The unbroken oocysts are moved from the vessel through the processing chamber and a portion of the oocyst membranes are disrupted releasing sporocysts, the resulting solution is moved from the processing chamber into the delivery outlet where the solution is delivered to an animal. Methods of vaccination, including vaccination against an Eimeria infection, are also provided.

This invention relates to berberine alkaloids, formulations thereof and their use for the prevention and / or treatment of infectious disease, especially disease caused by C. perfringens and Eimeria in animals. The invention also relates to impoving the feed conversion ratio in a food producing animal by administering berberine compositions.

The invention relates to application of a pericarpium zanthoxyli extract in preparation of a medicine, and belongs to the technical field of medical preparations. According to the application of the pericarpium zanthoxyli extract in preparing the medicine for preventing and / or treating the chicken eimeria tenella disease, when the pericarpium zanthoxyli extract is used for preparing the medicine for preventing and / or treating the chicken eimeria tenella disease, the prepared medicine has a good preventing and treating effect on the chicken eimeria tenella disease; meanwhile, as the Sichuan pepper extract is derived from Sichuan pepper, when the medicine prepared by taking the Sichuan pepper extract as an effective component is used for preventing and treating the chicken eimeria tenella coccidiosis, the generation of coccidiosis drug resistance is avoided, and the generation of drug residues which are finally harmful to human health is avoided.

The present application relates to primers and methods for distinguishing between wild-type and vaccine strains of Eimeria necrotica. The primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 2. The primers are used to distinguish between wild-type and vaccine strains of Eimeria necrotica, with simple operation, high reproducibility, and strong specificity.