Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Powdery mildew resistant grape calcium dependent protein kinase gene VpCDPK13 and application thereof

A technology of protein kinase gene and powdery mildew resistance, which is applied in application, genetic engineering, plant gene improvement, etc., can solve the problem of lack of report and research on glucose calcium-dependent protein kinase, so as to improve disease resistance and powdery mildew resistance , the effect of improving genetic traits

Active Publication Date: 2020-05-26
NORTHWEST A & F UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, there are few studies on the calcium-dependent protein kinases (CDPKs) of glucose, and there are no reports and studies on the calcium-dependent protein kinases of glucose with anti-powdery mildew function.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Powdery mildew resistant grape calcium dependent protein kinase gene VpCDPK13 and application thereof
  • Powdery mildew resistant grape calcium dependent protein kinase gene VpCDPK13 and application thereof
  • Powdery mildew resistant grape calcium dependent protein kinase gene VpCDPK13 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Cloning and expression analysis of the calcium-dependent protein kinase gene VpCDPK13 of East China grape Baihe-35-1

[0030] The total RNA of Baihe-35-1 grape leaves was extracted with the OMEGA Plant RNA Kit, and the extraction steps were carried out according to the instructions of the kit. According to the PrimeScriptTM RTreagentKit with gDNA Eraser (Perfect Real Time) reverse transcription kit from TaKaRa Company, RNA reverse transcription was performed to synthesize the first-strand cDNA, and the method was referred to the kit instructions. According to the VviCDPK13 gene sequence identified in the Pinot Noir grape genome published in NCBI, specific primers were designed using Vector NTI software. R: 5'ATGTTTTAACGCCTCTCTAAACCC 3' (SEQ ID NO: 6), using the leaf cDNA of 'Baihe-35-1' as a template, and using the high-fidelity enzyme PrimeSTAR HS DNA Polymerase from TAKARA Company for PCR amplification, the specific amplification system is: 0.5 μL HSTaq, 6...

Embodiment 2

[0042] Example 2: Analysis of the subcellular localization of the calcium-dependent protein kinase gene VpCDPK13 in East China grape Baihe-35-1

[0043] Design gene-specific primers with XbaI and KpnI restriction sites, upstream primer: VpCDPK13-GFP-F: 5'TCTGATCAAGAGACA TCTAGA ATGGGTAATACTTGTGTTGG 3' (SEQ ID NO: 7), downstream primer: VpCDPK13-GFP-R: 5' GCCCTTGCTCACCAT GGTACC ATGTTTTTAACGCCTCTCTAAACCC 3' (SEQ ID NO: 8) (the underlined font indicates the restriction site), and the coding sequence of VpCDPK13 was amplified with the pMD19T-VpCDPK13 plasmid as a template, using The PCR one-step directional cloning kit (seamless cloning) was connected to the plant overexpression vector pBI221 containing the GFP tag at an appropriate molar ratio through homologous recombination to construct a fusion overexpression vector 35S::VpCDPK13-GFP. Mix the 35S::VpCDPK13-GFP plasmid with equal amounts of 35S::AtCML5-mCherry, 35S::AtEMP12-mCherry, 35S::AtCLO3-mCherry, 35S::Ata-DOX1-mCherry...

Embodiment 3

[0044] Example 3: Obtaining and identification of transgenic non-nucleated white strains overexpressing calcium-dependent protein kinase VpCDPK13 in East China grape Baihe-35-1

[0045] Design gene-specific primers with BamHI restriction site, upstream primer: VpCDPK13-C15-F: 5'TCTGATCAAGAGACA GGATCC ATGGGTAATACTTGTGTTGG 3' (SEQ ID NO:9), downstream primer: VpCDPK13-C15-R: 5'GCCCTTGCTCACCAT GGATCC ATGTTTTAACGCCTCTCTAAACCC 3' (SEQ ID NO: 10) (the underline font indicates the restriction site), and the coding sequence of VpCDPK13 was amplified with the pMD19T-VpCDPK13 plasmid as a template, using The PCR one-step directional cloning kit (seamless cloning) was connected to the plant overexpression vector C15 containing the YFP tag (Wang et al., 2007) at an appropriate molar ratio through homologous recombination to construct a fusion overexpression vector 35S:: VpCDPK13-YFP. The 35S::VpCDPK13-YFP plasmid was transformed into Agrobacterium competent cells GV3101 by electropora...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Chinese wild East China grape Baihe-35-1 calcium-dependent protein kinase gene VpCDPK13 and an application thereof. The invention relates to the field of gene engineering, inparticular to the field of grape disease-resistant breeding. The calcium-dependent protein kinase gene VpCDPK13 is separated from the disease-resistant Chinese wild East China grape Baihe-35-1 plantgenome through a gene cloning technology, and is transferred into a powdery mildew susceptible grape plant to obtain a powdery mildew resistant transgenic grape plant, so that the powdery mildew resistance of grapes is improved.

Description

technical field [0001] The patent application of the present invention belongs to the field of plant stress resistance gene identification and genetic engineering technology, especially the isolation and identification of the grape calcium-dependent protein kinase gene resistant to powdery mildew, and more specifically relates to a plant isolated from the wild Chinese grape Baihe-35-1 Powdery mildew resistant grape calcium-dependent protein kinase gene VpCDPK13 and its application in powdery mildew resistance. Background technique [0002] Powdery mildew is an important fungal disease that seriously endangers grape production. It often leads to severe production reduction or even failure, resulting in huge economic losses. In order to prevent and control the disease, pesticides need to be sprayed 20-30 times a year in production, which seriously affects the edible safety of grape products, threatens human health, and pollutes the ecological environment (Gadoury et al., 2012)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54A01H5/00A01H6/88
CPCC12N9/1205C12Y207/11017C12N15/8282Y02A40/10
Inventor 文颖强胡洋程远余雪娜
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com