Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A gene TaABC1-2 with abc1-like kinase domain and its application

A domain and gene technology, applied in the field of genetic engineering, can solve the problems of lack of wheat powdery mildew genes, interference with powdery mildew infection, etc.

Active Publication Date: 2020-08-04
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Wheat and powdery mildew have formed a complex interaction system during the long-term evolution process. On the one hand, wheat has evolved a series of disease resistance genes and complex disease resistance mechanisms to resist the infection of powdery mildew and achieve disease resistance. Therefore, in wheat The introduction of disease-resistant genes in wheat can improve the resistance of wheat to powdery mildew; on the other hand, powdery mildew has also evolved a series of pathogenic effect factors and complex pathogenic mechanisms to infect plants to achieve the purpose of pathogenicity. Playing the role not only requires the participation of pathogenic effectors of pathogenic bacteria itself, but also needs to activate or utilize the susceptibility genes of wheat to achieve the purpose of successful infection. Therefore, reducing the expression of susceptibility genes in wheat can interfere with the infection of powdery mildew, as well as To achieve the purpose of improving the resistance of wheat to powdery mildew, but currently there is a lack of wheat powdery mildew genes available for genetic engineering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene TaABC1-2 with abc1-like kinase domain and its application
  • A gene TaABC1-2 with abc1-like kinase domain and its application
  • A gene TaABC1-2 with abc1-like kinase domain and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Cloning of ABC1-like kinase domain gene TaABC1-2 expressed in Yangmai 158 induced by powdery mildew

[0025] Nannong 9918 is a new disease-resistant, high-yield, high-quality wheat variety selected from Yangmai 158 / 92R137 / / Yangmai 158 by the Institute of Cytogenetics, Nanjing Agricultural University, using modern biotechnology and conventional breeding technology (Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yigao, Liu Dajun. Nannong 9918, a new wheat variety resistant to powdery mildew and high yield. Journal of Nanjing Agricultural University, 2002,25(4):1438-1444). Yangmai 158 is a wheat variety cultivated by the Agricultural Science Institute in Lixiahe District, Jiangsu Province, which is susceptible to powdery mildew.

[0026] In order to screen which genes of Yangmai 158 were induced by powdery mildew in the process of susceptibility to powdery mildew, our laboratory used high-throughput sequencing to obtain powdery mildew-resista...

Embodiment 2

[0028] Example 2 Expression analysis of TaABC1-2 in resistant Nannong 9918 and susceptible Yangmai 158

[0029]In order to study the expression pattern of TaABC1-2 in materials resistant to powdery mildew, the resistant material Nannong 9918 and the susceptible material Yangmai 158 were used as templates to reverse transcribe cDNA from RNA at 0 and 24 hours induced by powdery mildew, and use P3( TCCTCTCCGATAGCTGCAAG, SEQ ID NO.5) and P4 (GTTAGGCCGGTATGCTGTTG, SEQ ID NO.6) were used as primers for real-time fluorescent quantitative PCR (Q-PCR) analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCRMaster Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, an...

Embodiment 3

[0030] Example 3 Construction of TaABC1-2 interference vector pWMB006: TaABC RNAi

[0031] Interfering with TaABC1-2 gene expression pWMB006: The starting vector of TaABC RNAi is pWMB006 (TingtingChen, Jin Xiao, Jun Xu, Wentao Wan, Bi Qin, Aizhong Cao, Wei Chen, Liping Xing, ChenDu, Xiquan Gao, Shouzhong Zhang, Ruiqi Zhang, Wenbiao Shen, Haiyan Wang and XiueWang. Two members of TaRLK family confer powdery mildew resistance in commonwheat. BMC Plant Biology 2016 16:27 DOI: 10.1186 / s12870-016-0713-8). The construction process is as follows: 1. Using the cloned gene sequence of TaABC1-2 as a template, design primers P5 (TTGGATCCAGATCGACTGCACCC, SEQ ID NO.7) and P6 (TTGGTACCCACGAGTCACGACCT, SEQ ID NO.8), and P5 has the enzyme of BamHI Cutting site, P6 has a KpnI enzyme cutting site. 2. Using the plasmid containing the TaABC1-2 gene as a template, PCR amplification is performed on P5 and P6 using primers, and the amplified fragments are recovered. 3. Double digest the amplified p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and discloses a gene Ta (Triticum Asetivum L.) ABC1-2 having an ABC1-like kinase structural domain and application thereof. The gene TaABC1-2 having the ABC1-like kinase structural domain has a cDNA (Complementary Deoxyribonucleic Acid) sequence as shown in SEQ ID NO. 1 and an amino acid sequence coded by the gene TaABC1-2 as shown in SEQ ID NO. 2. The gene TaABC1-2 comes from triticum asetivum L. Yangmai 158. The expression of the gene TaABC1-2 in a powdery mildew-infected wheat variety-Yangmai 158 under induction of albugo candida is enhanced, and the expression level is far higher than that in a disease-resistant wheat variety-Nannong 9918. An interference expression vector is obtained by inserting a forward sequence of the gene TaABC1-2 between BamHI and KpnI restriction enzyme cutting sites of pWMB006 and simultaneously inserting a reverse sequence between SpeI and SacI of the Pwmb006, powdery mildew-infected wheat variety-Yangmai 158 is converted, and a powdery mildew-resistant identification result of a positive transformation plant shows that the resistance of the powdery mildew-infected wheat variety on powdery mildew can be increased through reduced expression of the gene TaABC1-2.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a gene TaABC1-2 with an ABC1-like kinase domain and its application. Background technique [0002] Wheat is one of the most important food crops in my country and the world, but its growth and development are subject to various abiotic and biotic stresses. Wheat powdery mildew caused by Blumeria graminis f.sp tritici is one of the main diseases of wheat. It is a specialized parasitism, which can infect the leaves, stems, ears, etc. of wheat throughout the growth period. It mainly damages the leaves of wheat, and in severe cases affects the normal photosynthesis of wheat, thereby affecting its normal growth and reducing yield. In general, wheat powdery mildew can cause a 5-19% reduction in wheat yield, and in severe cases it can reduce wheat yield by more than 30%. Since the 1990s, the incidence area of ​​wheat powdery mildew in the country is more than 6 million hectares every ye...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/12C12N15/8282
Inventor 曹爱忠邢莉萍杨文武周传玉徐杰飞胡平刘佳倩张瑞奇张守忠陈佩度
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products