A hemopexin gene tahbp1 and its recombinant interference vector and application

A technology that interferes with vectors and genes, applied in the field of genetic engineering, can solve the problem of lack of wheat powdery mildew genes, and achieve the effect of improving powdery mildew resistance and improving resistance

Active Publication Date: 2022-04-01
NANJING AGRICULTURAL UNIVERSITY
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Wheat powdery mildew is a biotrophic pathogen, and successful infection of wheat needs to activate the expression of some wheat genes (PanstrugaR, Schulze-Lefert P.Corruption of host seven-transmembrane proteins bypathogenic microbes: a common theme in animals and plants [J].Microbes and Infection, 2003,5(5):429-437), mutation or interference with the expression of this part of the gene can achieve the purpose of inhibiting the infection of wheat powdery mildew, but the wheat powdery mildew that can be used by genetic engineering is currently gene relative lack

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A hemopexin gene tahbp1 and its recombinant interference vector and application
  • A hemopexin gene tahbp1 and its recombinant interference vector and application
  • A hemopexin gene tahbp1 and its recombinant interference vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Cloning of the gene TaHBP1 with a heme-binding domain induced by powdery mildew in Yangmai 158

[0024] Nannong 9918 is a new disease-resistant, high-yield, high-quality wheat variety selected from Yangmai 158 / 92R137 / / Yangmai 158 by the Institute of Cytogenetics, Nanjing Agricultural University, using modern biotechnology and conventional breeding technology (Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yigao, Liu Dajun. Nannong 9918, a new wheat variety resistant to powdery mildew and high yield. Journal of Nanjing Agricultural University, 2002,25(4):1438-1444), SM-1 is Nannong 9918 EMS susceptible mutants (Xing L, Hu P, Liu J, Witek K, Zhou S, Xu J, Zhou W, Gao L, Huang Z, Zhang R, Wang X, Chen P, Wang H, Jones JDG, Karafiátová M, Vrána J, J, J,Tian Y,Wu Y,Cao Pm21from Haynaldiavillosa Encodes a CC-NBS-LRR protein conferring powdery mildew resistance inwheat.Molecular Plant,2018 11(4):874-878), broad-spectrum high resistance to whea...

Embodiment 2

[0027] Example 2 Expression analysis of TaHBP1 in resistant Nannong 9918 and susceptible Yangmai 158

[0028] In order to study whether TaHBP1 is also down-regulated by powdery mildew in other disease-resistant materials, the disease-resistant wheat varieties Shimai 14 (publicly known and public, Jishenmai 2004005) and Neimai 8 (publicly known and public) containing the powdery mildew resistance gene Pm21 were used. , Chuan Shenmai 2003003), Lantian 17 (commonly known and public, Ganshenmai 2005011) were induced by powdery mildew for 0 and 24 hours by RNA reverse transcription cDNA as a template, using P3 (TGAAGCGTGAGGAGGAGTAC, SEQ ID NO.5) and P4 ( AGAGATTTCCGCAACCTGGA, SEQ ID NO.6) was used as a primer for real-time fluorescent quantitative PCR (Q-PCR) analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contain...

Embodiment 3

[0029] Example 3 TaHBP1 interference vector pWMB006:TaHBP RNAi build

[0030] RNAi Vector pWMB006:TaHBP1 Interfering with TaHBP1 Gene Expression RNAi The starting carrier is pWMB006 (Tingting Chen, Jin Xiao, Jun Xu, Wentao Wan, Bi Qin, Aizhong Cao, Wei Chen, Liping Xing, Chen Du, Xiquan Gao, Shouzhong Zhang, Ruiqi Zhang, Wenbiao Shen, Haiyan Wang and Xiue Wang.Two members of TaRLK family confer powdery mildew resistance in common wheat. BMC Plant Biology 2016 16:27 DOI:10.1186 / s12870-016-0713-8). The construction process is as follows: 1. Using the cloned TaHBP1 gene sequence as a template, design primers P5 (TTGGATCCTGAAGCGTGAGGAGGAGTAC, SEQ ID NO.7) and P6 (TTGGTACCAGAGATTTCCGCAACCTGGA, SEQ ID NO.8), and P5 has a BamHI restriction site point, P6 has a KpnI restriction site. 2. Using the plasmid containing the TaHBP1 gene as a template, PCR amplification was performed using primer pairs P5 and P6, and the amplified fragment was recovered. 3. Digest the amplified product w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering, and discloses a gene TaHBP1 with a heme-binding (Heme-binding) domain, its recombination interference carrier and its application. The cDNA sequence of the gene TaHBP1 with Heme-binding domain is SEQ ID NO.1 and the encoded amino acid sequence is SEQ ID NO.2. The gene is from common wheat (Triticum asetivum L.) Yangmai 158. The expression of TaHBP1 in powdery mildew-susceptible wheat variety Yangmai 158 was induced by powdery mildew, and the expression level was much higher than that in disease-resistant wheat variety Nannong 9918. The forward sequence of TaHBP1 was inserted between the BamHI and KpnI restriction sites of pWMB006, and the reverse sequence was inserted between SpeI and SacI of pWMB006 to obtain an interference expression vector, and the wheat variety Yangmai 158 susceptible to powdery mildew was transformed, and the positively transformed plants The powdery mildew resistance identification results showed that the reduced expression of TaHBP1 could improve the resistance of powdery mildew susceptible wheat cultivars to powdery mildew.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses a gene TaHBP1 with a heme-binding (Heme-binding) domain, its recombination interference carrier and its application. Background technique [0002] Wheat is one of the most important food crops in my country and the world, but its growth and development are subject to various abiotic and biotic stresses. Wheat powdery mildew caused by the obligate parasitic fungus Blurmeria graminis f.sp.tritici (Bgt) is a worldwide fungal disease that mainly affects the aerial parts of wheat plants, including leaves and leaf sheaths, and can also damage stems and ears of wheat. Wheat powdery mildew mainly occurs in wheat seedling and adult plant stages. After powdery mildew infects wheat, it not only robs the plant of nutrients, but also covers the surface of the wheat plant with its mycelium layer, which reduces the photosynthetic efficiency of the plant, reduces the accumulation and transport o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC12N15/8282C07K14/415
Inventor邢莉萍曹爱忠黄振朴刘佳倩杨文武徐杰飞张瑞奇王秀娥张守忠
OwnerNANJING AGRICULTURAL UNIVERSITY