Recombinant strain of Escherichia coli producing levodopa and its construction method and application

A recombinant strain, a technology of levodopa, applied in the biological field, can solve the problems such as the urgent need to improve the output of levodopa and the inability to meet the market demand and the like

Active Publication Date: 2020-12-01
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But this output still can't meet market demand, the output of levodopa needs to be improved urgently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant strain of Escherichia coli producing levodopa and its construction method and application
  • Recombinant strain of Escherichia coli producing levodopa and its construction method and application
  • Recombinant strain of Escherichia coli producing levodopa and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0124] The construction of embodiment 1 escherichia coli recombinant strain T002

[0125] With the plasmid pEASY-cat-sacB (as shown in SEQ ID NO:5) containing chloramphenicol resistance gene cat and fructan sucrose transferase gene sacB figure 2 (shown) is a template, and primer 21 aroE1-up / aroE1-down is used to amplify the fragment aroE1 of homologous recombination in the first step. The sequence of primer 21 is:

[0126] aroE1-up (forward primer):

[0127] GATGCCCTGACGGGTGAACTGTTTCGACAGGGGTAACATA GTGACGGAAGATCACTTC

[0128] aroE1-down (reverse primer):

[0129] CTGTGGGCTATCGGATTACCAAAAACAGCATAGGTTTCCA ATCAAAGGGAAAACTGTCC

[0130] Amplification system: 5×TransStart TM FastPfu Buffer 10μL, dNTPs (2.5mmol / L each dNTP) 4μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 2μL, reverse primer (10μmol / L) 2μL, 100% DMSO 1μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL.

[0131] The amplification conditions are: 94°...

Embodiment 2

[0151] The construction of embodiment 2 escherichia coli recombinant strain T004

[0152] With the plasmid pEASY-cat-sacB (as shown in SEQ ID NO:5) containing chloramphenicol resistance gene cat and fructan sucrose transferase gene sacB figure 2 (shown) is used as template, and primer t41 hpaBC-up / hpaBC-down is used to amplify the fragment hpaBC1 of homologous recombination in the first step. The primer t41 sequence is:

[0153] hpaBC-up (forward primer):

[0154] AACTATGAACATTGTCGATCAACAAACTTTTCGCGATGCG GTGACGGAAGATCACTTC

[0155] hpaBC-down (reverse primer):

[0156] TCCGTGGTGATGATATTGACCGCCGCGCCCATGCAGGACA ATCAAAGGGAAAACTGTCC

[0157] Amplification system: 5×TransStart TM FastPfu Buffer 10μL, dNTPs (2.5mmol / L each dNTP) 4μL, DNA template 1μL (20-50ng), forward primer (10μmol / L) 2μL, reverse primer (10μmol / L) 2μL, 100% DMSO 1μL, TransStart TM FastPfu DNA Polymerase (2.5U / μL) 1 μL, deionized water 29 μL, total volume 50 μL.

[0158] The amplification conditions...

Embodiment 3

[0180] Example 3 Escherichia coli recombinant strain WJ060, recombinant strain T002 and recombinant strain T004 fermented to produce levodopa

[0181] The various components in the seed medium or fermentation medium mentioned in the present invention and their content, fermentation temperature, pH value of the fermentation system, fermentation time, and inoculum size can be adjusted accordingly according to needs. E.g:

[0182] The initial glucose content is 20g / L-100g / L, specifically 20g / L or 30g / L or 40g / L or 50g / L or 60g / L or 70g / L or 80g / L or 90g / L or 100g / L etc. (after the start of fermentation, when the glucose concentration in the fermenter drops below 1g / L, start feeding with a glucose solution with a concentration of 500g / L-600g / L, and control the feeding speed so that the glucose concentration in the fermenter less than 1g / L);

[0183] The content of yeast extract is 0-5g / L, specifically 0g / L or 1g / L or 2g / L or 3g / L or 4g / L or 5g / L;

[0184] The content of trypto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an escherichia coli recombination strain T002 for producing levodopa as well as a construction method and application thereof. According to the escherichia coli recombination strain, expression of 3-dehydrogenase shikimate dehydrogenase (aroE) is up regulated to enhance enzyme activity of 3-dehydrogenation shikimate dehydrogenase, and the levodopa can be further produced. The strain can produce the levodopa by utilizing glucose inorganic salt culture medium production, culture medium cost is reduced, and production cost of the levodopa is reduced. Furthermore, the recombination strain has the advantages of no plasmid and stable hereditary.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to recombinant Escherichia coli for producing levodopa and its construction method and application. Background technique [0002] Levodopa (L-DOPA), also known as 3-hydroxyl-L-tyrosine, is an amino acid derivative with remarkable effects in medicine, hygiene, health care and beauty. Since 1908, it has been widely used clinically all over the world. Levodopa is currently the most effective drug for treating parkinsonism. It enters the brain tissue through the blood-brain barrier and plays a role. It is suitable for primary parkinsonism and non-pharmaceutical parkinsonia syndrome. At the same time, it has curative effects on stiffness, dyskinesia, salivation, and arterial crisis. Levodopa is an intermediate in the formation of catecholamines from tyrosine, the precursor of dopamine. About 95% of L-dopa absorbed into the blood is decarboxylated by dopa decarboxylase in peripheral tiss...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/53C12P13/22C12R1/19
Inventor马延和王钦宏陈五九曹鹏彭彦峰吴凤礼张媛媛
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI