Application of soybean gmcry1b gene in regulation of plant height and flowering time
A technology of flowering time and soybean, applied in the field of genetic engineering, can solve the problems of affecting soybean yield, restricting the popularization and utilization of soybean varieties, etc., and achieves the effect of good application prospect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Construction of soybean GmCRY1b gene overexpression plant expression vector
[0031] 1. The present invention provides primers for constructing overexpression vectors, primers for amplifying the GmCRY1b CDS sequence:
[0032] CDS-1bF:ATGTCAGGTGGTGGATGC
[0033] CDS-1bR:CCCAGTTTGAGGTAGCTG
[0034] Universal primers for homologous recombination ligation of the pDONRzeo entry vector:
[0035] pCRY1b-F:CAAAAAAGCAGGCTTCATGTCAGGTGGTGGATGC
[0036] pCRY1b-R:CAAGAAAGCTGGGTCCCCAGTTTGAGGTAGCTG
[0037] 2. Take the seeds of soybean William 82, plant them in a 1:1 mixed soil containing nutrient soil and vermiculite, and grow for 15 days under short-day sunshine. Take 2 pieces of soybean leaves. RNA was extracted by conventional methods, and the obtained RNA was stored in a -80°C refrigerator.
[0038] 3. Reverse transcription to synthesize cDNA
[0039] 4. Use the designed GmCRY1b cDNA amplification primers, and use the reverse transcription product as a template t...
Embodiment 2
[0042] The acquisition of embodiment 2 transgenic soybean plants
[0043] After the plasmid containing GmCRY1b cDNA constructed in Example 1 was transformed into Agrobacterium, soybean transformation was carried out.
[0044] 1. Preparation of Agrobacterium Competent: Pick single colonies of Agrobacterium EHA105 and place them in 5 ml of LB liquid medium containing corresponding antibiotics. The resistance of EHA105 is: 100 μg / ml rifampicin (Rif). Cultivate overnight at 28°C; take 500 μl of the overnight culture and inoculate it into 50ml LB liquid medium containing the corresponding antibiotics, cultivate at 28°C until the OD600 is about 0.5; place on ice for 30 minutes; centrifuge at 5,000 rpm for 10 minutes at 4°C, and pre-cool with 15ml 10mM CaCl 2 Resuspend Agrobacterium cells, centrifuge at 5,000rpm for 10min at 4°C; use 2ml pre-cooled 10mM CaCl 2 Resuspend the pellet, aliquot 100 μl / tube on ice, freeze in liquid nitrogen, and store at -80°C.
[0045] 2. Agrobacterium...
Embodiment 3
[0049] Identification of embodiment 3 transgenic positive strains
[0050] In order to determine the transgenic positive plants obtained in Example 2, take a piece of fresh and tender leaves, extract the total protein, and perform Western blot (Westernblotting). The pEARLY101 vector contains YFP protein, and the YFP antibody is used to identify positive plants.
[0051] The transgenic soybean overexpression plants Cry1b-OX-1, Cry1b-OX-2 and Cry1b-OX-3 obtained in Example 2 were detected respectively. The results of western-blot detection with YFP are shown in figure 1 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

