Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of soybean gmcry1b gene in regulation of plant height and flowering time

A technology of flowering time and soybean, applied in the field of genetic engineering, can solve the problems of affecting soybean yield, restricting the popularization and utilization of soybean varieties, etc., and achieves the effect of good application prospect.

Active Publication Date: 2020-12-01
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because soybeans are very sensitive to photoperiods, they can only flower and bear fruit under specific photoperiod conditions, so a certain high-quality variety is limited to planting in a specific area (latitude), and in areas with a difference of 1.5 latitudes, it will be due to The difference in photoperiod between regions significantly affects the yield of soybean, which seriously restricts the promotion and utilization of soybean varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean gmcry1b gene in regulation of plant height and flowering time
  • Application of soybean gmcry1b gene in regulation of plant height and flowering time

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of soybean GmCRY1b gene overexpression plant expression vector

[0031] 1. The present invention provides primers for constructing overexpression vectors, primers for amplifying the GmCRY1b CDS sequence:

[0032] CDS-1bF:ATGTCAGGTGGTGGATGC

[0033] CDS-1bR:CCCAGTTTGAGGTAGCTG

[0034] Universal primers for homologous recombination ligation of the pDONRzeo entry vector:

[0035] pCRY1b-F:CAAAAAAGCAGGCTTCATGTCAGGTGGTGGATGC

[0036] pCRY1b-R:CAAGAAAGCTGGGTCCCCAGTTTGAGGTAGCTG

[0037] 2. Take the seeds of soybean William 82, plant them in a 1:1 mixed soil containing nutrient soil and vermiculite, and grow for 15 days under short-day sunshine. Take 2 pieces of soybean leaves. RNA was extracted by conventional methods, and the obtained RNA was stored in a -80°C refrigerator.

[0038] 3. Reverse transcription to synthesize cDNA

[0039] 4. Use the designed GmCRY1b cDNA amplification primers, and use the reverse transcription product as a template t...

Embodiment 2

[0042] The acquisition of embodiment 2 transgenic soybean plants

[0043] After the plasmid containing GmCRY1b cDNA constructed in Example 1 was transformed into Agrobacterium, soybean transformation was carried out.

[0044] 1. Preparation of Agrobacterium Competent: Pick single colonies of Agrobacterium EHA105 and place them in 5 ml of LB liquid medium containing corresponding antibiotics. The resistance of EHA105 is: 100 μg / ml rifampicin (Rif). Cultivate overnight at 28°C; take 500 μl of the overnight culture and inoculate it into 50ml LB liquid medium containing the corresponding antibiotics, cultivate at 28°C until the OD600 is about 0.5; place on ice for 30 minutes; centrifuge at 5,000 rpm for 10 minutes at 4°C, and pre-cool with 15ml 10mM CaCl 2 Resuspend Agrobacterium cells, centrifuge at 5,000rpm for 10min at 4°C; use 2ml pre-cooled 10mM CaCl 2 Resuspend the pellet, aliquot 100 μl / tube on ice, freeze in liquid nitrogen, and store at -80°C.

[0045] 2. Agrobacterium...

Embodiment 3

[0049] Identification of embodiment 3 transgenic positive strains

[0050] In order to determine the transgenic positive plants obtained in Example 2, take a piece of fresh and tender leaves, extract the total protein, and perform Western blot (Westernblotting). The pEARLY101 vector contains YFP protein, and the YFP antibody is used to identify positive plants.

[0051] The transgenic soybean overexpression plants Cry1b-OX-1, Cry1b-OX-2 and Cry1b-OX-3 obtained in Example 2 were detected respectively. The results of western-blot detection with YFP are shown in figure 1 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a soybean GmCRY1b gene in regulating and controlling plant height and flowing time. A nucleic acid sequence of the soybean GmCRY1b gene is shown in SEQ ID NO.1, and an amino acid sequence for coding protein is shown in SEQ ID NO.2. The application of the soybean GmCRY1b gene in regulating and controlling the plant height and flowing time has the advantages that the soybean GmCRY1b gene is overexpressed by a pEARLY101 carrier in a gateway system, the soybean cultivation variety Tianlong No.1 is converted, and the stable overexpressed plant is obtained; found in study, compared with the wild type plant, the height of the overexpressed plant is lower, the flowering time is earlier, and the GmCRY1b gene participates in the biology process of regulating andcontrolling the plant height and flowering time; the gene has a good application prospect in the technical field of seed breeding.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular to a soybean GmCRY1b gene and its application in regulating plant height and flowering time. Background technique [0002] Soybean is one of the important food, oil and feed crops in the world, which is closely related to the national economy. my country is rich in soybean resources, and there are many high-quality varieties with high yield, high oil, high protein, strong disease resistance and stress resistance. However, because soybeans are very sensitive to photoperiods, they can only flower and bear fruit under specific photoperiod conditions, so a certain high-quality variety is limited to planting in a specific area (latitude), and in areas with a difference of 1.5 latitudes, it will be due to The difference in photoperiod between regions significantly affects the yield of soybean, which seriously restricts the promotion and utilization of soybean varieties. Changing the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/54
CPCC07K14/415C12N15/825C12N15/8261C12N15/827
Inventor 刘军李向光秦超刘斌赵涛李宏宇
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI