Unlock instant, AI-driven research and patent intelligence for your innovation.

A group of fucosyltransferase mutants and their screening methods and applications

A technology of glycosyltransferase and fucosyl, applied in the direction of glycosyltransferase, transferase, application, etc., can solve the problems of large and expensive substrates, high screening cost, and time-consuming

Active Publication Date: 2021-10-22
SHANGHAI JIAOTONG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing methods are based on 96-well plates for screening, which require a large number of expensive substrates, high screening costs, time-consuming, laborious, and low screening throughput (no more than 10 5 ) and other weaknesses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A group of fucosyltransferase mutants and their screening methods and applications
  • A group of fucosyltransferase mutants and their screening methods and applications
  • A group of fucosyltransferase mutants and their screening methods and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Embodiment 1, establishment of FutA ultra-high-throughput screening method

[0084] In order to construct an ultra-high-throughput screening method for FutA, based on the high-throughput screening strategy of FACS fucosyltransferase, we carried out screening host strain construction, fluorescent substrate design and synthesis, and a series of optimization of screening conditions. Schema filter. The specific operation is as follows:

[0085] 1. Construction of special E. coli strains for screening

[0086] We choose Escherichia coli cell JM107NanA- as a special cell for screening. The cell itself lacks the activity of β-galactosidase (LacZ) to prevent the decomposition of the product. It also has galactose permease (LacY) and fucose transporter (FucP ) activity, which meets the needs of the screening system. In addition, GDP-fucose in Escherichia coli is synthesized under the action of GDP-fucose synthetase (FKP), so we transformed the recombinant plasmid fkp-packc18 ...

Embodiment 2

[0095] Example 2 Construction of FutA mutant library

[0096] 1. Construction of FutA random mutation library

[0097] Using error-prone PCR technology, using the pUC18 plasmid with the wild-type futA gene (SEQ ID NO: 1, encoding a protein such as SEQ ID NO: 2) as a template, using a low-fidelity DNA polymerase to amplify the target gene, by Increase the concentration of magnesium ions, add manganese ions, and change the concentration of four kinds of dNTPs in the system to change the mutation frequency during the amplification process, so as to randomly introduce mutations into the target gene at a certain frequency.

[0098] The primer sequences are as follows:

[0099] Upstream primers:

[0100] 5'CCGGAATTCGCATATGTTTCAGCCGCTGC 3' (SEQ ID NO: 3)

[0101] Downstream primers:

[0102] 5' AATCCCAAGCTTTCAGTGGTGGTGGTGGTGGTGC 3' (SEQ ID NO: 4)

[0103] The system is as follows:

[0104]

[0105]

[0106] The PCR reaction conditions were as follows: first, pre-denaturat...

Embodiment 3

[0136] Example 3 High-throughput screening of mutant libraries

[0137] 1. FACS screening of mutant library

[0138] Electrotransform the plasmid of the mutant library into JM107(FKP), recover in 800ul 2YT 37°C for 45 minutes, take 10ul to coat the plate, count the number of colonies the next day to calculate the library capacity, and add the rest to the 4ml solution containing 100μg / mL of ampicillin and chloramphenicol in LB tubes. Incubate overnight at 37°C. The next day, 2% of the inoculum was transferred to M9 medium containing 100ug / ml L-ampicillin and chloramphenicol, cultured for 6 hours, and then induced with 0.8mM IPTG for 16 hours. After collecting the bacteria by centrifugation, react with 0.1mM fluorescent substrates LacNAc-Coumarin and LacNAc-Bodipy and 5mM fucose for half an hour, then wash to remove unbound fluorescent substrates. The specific cleaning process is as follows:

[0139] Add 1ml of LB medium, centrifuge at 5000rpm for 3 minutes to collect the ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a group of mutants of fucosyltransferase and their screening method and application. The present invention obtains a group of fucosyltransferase mutants with significantly improved catalytic activity through the design of fluorescent substrates for fucosyltransferases and in combination with the high-throughput screening method of flow cytometry fluorescence sorting. The invention also relates to the application of the fucosyltransferase mutant in the synthesis of fucosylated oligosaccharides and glycoconjugates thereof.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically, the invention relates to a group of α1,3-fucosyltransferase mutants with improved catalytic activity. Background technique [0002] Fucosylation is a common glycosylation modification in organisms and plays an irreplaceable and important role in many complex physiological processes. Many fucosyl-containing abnormal sugar chain structures are closely related to the occurrence and development of tumors, so fucosyl-containing oligosaccharides and glycoconjugates (including glycoproteins, glycolipids, etc.) can be used as key molecules for tumor diagnosis Markers have also been researched and developed into anti-tumor sugar vaccines for cancer immunotherapy. Moreover, human milk is rich in fucosylated oligosaccharides, which are important prebiotics, which have the functions of enhancing infant immunity and promoting brain development, and can be used in infant formula milk powder...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12P19/18
CPCC12N9/1051C12P19/18C12Y204/01065
Inventor 杨广宇谭玉萌冯雁韩云宾刘新平
Owner SHANGHAI JIAOTONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com