A group of fucosyltransferase mutants and their screening methods and applications
A technology of glycosyltransferase and fucosyl, applied in the direction of glycosyltransferase, transferase, application, etc., can solve the problems of large and expensive substrates, high screening cost, and time-consuming
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] Embodiment 1, establishment of FutA ultra-high-throughput screening method
[0084] In order to construct an ultra-high-throughput screening method for FutA, based on the high-throughput screening strategy of FACS fucosyltransferase, we carried out screening host strain construction, fluorescent substrate design and synthesis, and a series of optimization of screening conditions. Schema filter. The specific operation is as follows:
[0085] 1. Construction of special E. coli strains for screening
[0086] We choose Escherichia coli cell JM107NanA- as a special cell for screening. The cell itself lacks the activity of β-galactosidase (LacZ) to prevent the decomposition of the product. It also has galactose permease (LacY) and fucose transporter (FucP ) activity, which meets the needs of the screening system. In addition, GDP-fucose in Escherichia coli is synthesized under the action of GDP-fucose synthetase (FKP), so we transformed the recombinant plasmid fkp-packc18 ...
Embodiment 2
[0095] Example 2 Construction of FutA mutant library
[0096] 1. Construction of FutA random mutation library
[0097] Using error-prone PCR technology, using the pUC18 plasmid with the wild-type futA gene (SEQ ID NO: 1, encoding a protein such as SEQ ID NO: 2) as a template, using a low-fidelity DNA polymerase to amplify the target gene, by Increase the concentration of magnesium ions, add manganese ions, and change the concentration of four kinds of dNTPs in the system to change the mutation frequency during the amplification process, so as to randomly introduce mutations into the target gene at a certain frequency.
[0098] The primer sequences are as follows:
[0099] Upstream primers:
[0100] 5'CCGGAATTCGCATATGTTTCAGCCGCTGC 3' (SEQ ID NO: 3)
[0101] Downstream primers:
[0102] 5' AATCCCAAGCTTTCAGTGGTGGTGGTGGTGGTGC 3' (SEQ ID NO: 4)
[0103] The system is as follows:
[0104]
[0105]
[0106] The PCR reaction conditions were as follows: first, pre-denaturat...
Embodiment 3
[0136] Example 3 High-throughput screening of mutant libraries
[0137] 1. FACS screening of mutant library
[0138] Electrotransform the plasmid of the mutant library into JM107(FKP), recover in 800ul 2YT 37°C for 45 minutes, take 10ul to coat the plate, count the number of colonies the next day to calculate the library capacity, and add the rest to the 4ml solution containing 100μg / mL of ampicillin and chloramphenicol in LB tubes. Incubate overnight at 37°C. The next day, 2% of the inoculum was transferred to M9 medium containing 100ug / ml L-ampicillin and chloramphenicol, cultured for 6 hours, and then induced with 0.8mM IPTG for 16 hours. After collecting the bacteria by centrifugation, react with 0.1mM fluorescent substrates LacNAc-Coumarin and LacNAc-Bodipy and 5mM fucose for half an hour, then wash to remove unbound fluorescent substrates. The specific cleaning process is as follows:
[0139] Add 1ml of LB medium, centrifuge at 5000rpm for 3 minutes to collect the ce...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


