PtgC1qR gene of C1q receptor of blue crab as well as coding protein and application thereof

A technology of swimming crab trituratus and gene coding, which is applied in the field of molecular biology and can solve the problems such as the report of the C1q receptor gC1qR of the swimming crab trituratus that has not yet been found.

Active Publication Date: 2018-09-21
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] So far, although some studies have focused on the function of gC1qR in cru...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PtgC1qR gene of C1q receptor of blue crab as well as coding protein and application thereof
  • PtgC1qR gene of C1q receptor of blue crab as well as coding protein and application thereof
  • PtgC1qR gene of C1q receptor of blue crab as well as coding protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The PtgC1qR gene of Portunus trituberculatus C1q receptor is the base sequence shown in SEQ ID No.1.

[0032] The sequence listing SEQ ID No.1 is:

[0033]TCTCACTTCTCCCTTAATTTTCGCCCTTATTTGTGGTCCCAGCGCCCTAAAACTCCCTGGAATGTTGCGTGGAGCCCTGAGCCGGGGGTTGGTGTCCTCGACGTGTCTTCAGGGGCGTGTCATGTCCCTAAATACGCCAATAATTAGAAATATTGCCCTAGTGTCCTGTTGTTCTCCTCCATCCCCGGGCCGGCCTTCCTCTTCCTCTTCTTCTTGCCCTCCACGCCTCGCCACGCCCTCCAAGCTGTGTTCCTGTGGCTGTGGCATTCACGGCATCCACACGAGAGGTGACCGGGAGCTGGTGGAGTTCCTGCAGGAGGAGATCGTGGCGGAGAGGAAGACTTTGCAGCCAAACCTTCCCTCACACCTTGGGGACTTTGCTGTCAAGGGGACCAGTGCCGAGCTCACCCTCTCCCGCTCCTTCCATGATGAAAAAATCACCATCACCCTCAACGTGAACCACACCGTCGACCAGGAGGATGAAGGCAgTGCTGAGCTGACCCAGGACCAGACGGAGGCACTGCTGAAGAGTCGGCCAAGCTTCGAGGTGGACATAGTGATCGGAGCCAAGACACTCTCCTTTACCTGCTCCTTTGTCGGCCCAGCGGAGGTGCAGGGCGGGCAGGAGGAAGATGTGTTTGGCATCAACGAACTGACCATCTATGAAGGGGAGTGGTCCGAGGCAACCTATTGTGTGTCTGGGGATATTCTCGATGGGATGATGTACGACCTACTAATGAACATGCTGGAGGAACGAGGGGTCACTAATGAATTTGCCGAACAGCTCAGCACTCTCTGTTCTGAGTATGAGCACTCTCTCTATGTGGGCCT...

Embodiment 2

[0065] The base sequence of Portunus trituberculatus C1q receptor PtgC1qR is described in SEQ ID No. 1 in the sequence listing, and the amino acid sequence is described in SEQ ID No. 2 in the sequence listing.

[0066] The sequence listing SEQ ID No.2 is:

[0067]

[0068] It has a complete coding protein containing 268 amino acids, the coding sequence has no signal peptide, the predicted molecular weight is 29.36kDa, and the isoelectric point is 4.81. The mature peptide has a typical 33 kDa mitochondrial acidic matrix protein (MAM33p) domain.

[0069] The specific operation for obtaining the PtgC1qR recombinant protein of Portunus trituberculatus C1q receptor is as follows:

[0070] According to the cDNA sequence corresponding to SEQ ID No.2, design specific primers F3 (5'CGCGGATCCATGTTGCGTGGAGCCCTG 3') and R3 (5'CCGCTCGAGCACGAAATCCTGAAGGCGC 3') containing restriction endonuclease BamHI and XhoI restriction sites, by PCR technology The gene fragment encoding the mature p...

Embodiment 3

[0072] 1. Phenoloxidase inhibition test of PtgC1qR recombinant protein of Portunus trituberculatus:

[0073] Preparation of Portunus trituberculatus blood cell crush supernatant (HLS): extract blood cells from Portunus trituberculatus, quickly add to anticoagulant, and centrifuge for 10 minutes to obtain blood cell pellet. After the pellet was resuspended with 0.1M PBS (pH=7.0), it was beaten 4 times with 20kHz / 100W ultrasonic waves, and after each 30s, centrifuged at 12,000rpm at 4 degrees for 10min to remove the pellet. The supernatant is the blood cell lysis supernatant (HLS), and put it in a 4°C refrigerator for later use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention belongs to the technical field of molecular biology and particularly relates to a PtgC1qR gene of a C1q receptor of a blue crab as well as coding protein and application thereof. The PtgC1qR gene of the C1q receptor of the blue crab is as shown in a base sequence in a sequence table SEQ ID NO. 1. A cDNA library and a RACE technology are utilized for amplifying the blue crab to obtainthe cDNA of the PtgC1qR gene, and recombinant PtgC1qR protein has obvious phenol oxidase inhibition activity, antibacterial activity and microbial binding activity. The invention lays a foundation for disease control and gene-assisted selective breeding of the blue crab and has potential application value in the aspects of development of aquatic drugs, production of feed additives and the like.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to a C1q receptor PtgC1qR gene of Portunus trituberculatus and its encoded protein and application. Background technique [0002] Portunus trituberculatus (Portunus trituberculatus) is an important marine economic crab in my country. Due to its large size, rich nutrition, and rapid growth, it has become an important marine aquaculture species in my country. However, with the continuous expansion of the breeding scale and the continuous improvement of industrialization and intensification, various diseases caused by bacteria, fungi and viruses have frequently broken out in the Portunus trituberculatus breeding groups, causing huge losses to the Portunus trituberculatus aquaculture industry. Restricted the healthy and sustainable development of Portunus trituberculatus aquaculture industry. Therefore, to carry out basic research on immune and epidemic prevention ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/705C12N15/12A23K20/147A23L3/3526A61K38/17A61P31/04A61P37/04
CPCA23L3/3526A61K38/00A23K20/147A61P31/04A61P37/04C07K14/705
Inventor 刘媛宁军号崔朝霞宋呈文刘厚荣
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap