Kit used for detecting human MTHFR and MTRR gene polymorphism, and detection method thereof

A gene polymorphism and kit technology, applied in the field of biomedicine, can solve the problems of high requirements for gene chip development machines, expensive instruments, long detection cycle of sequencing methods, etc., and achieve simple and objective result interpretation, high specificity and sensitivity, and results Authentic and believable effects

Inactive Publication Date: 2018-12-14
SHUWEN BIOTECH CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the sequencing method has a long detection cycle, complicated operation, low sensitivity and expensive instruments, which is not conducive to popularization; gene chip generation machines require high requirements and are expensive, which is not conducive to large-scale promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit used for detecting human MTHFR and MTRR gene polymorphism, and detection method thereof
  • Kit used for detecting human MTHFR and MTRR gene polymorphism, and detection method thereof
  • Kit used for detecting human MTHFR and MTRR gene polymorphism, and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Design specific primers and specific probes according to the target gene sequence, and the designed primers and probes can be artificially synthesized according to existing methods. Specific primers and probes are as follows:

[0068] Primer 1 (MTHFR 677-Fo): 5'TGTCAGCCTCAAAAGAAAAGCT3'

[0069] Primer 2 (MTHFR 677-Re): 5'GCTGACCTGAAGCACTTGAAG3'

[0070] Primer 3 (MTHFR 1298-Fo): 5'CCCGAGAGGTAAAGAACGAA3'

[0071] Primer 4 (MTHFR 1298-Re): 5'GGAGCTGCTGAAGATGTGG3'

[0072] Primer 5 (MTRR 66-Fo): 5'CAGCAGGGACAGGCAAAG3'

[0073] Primer 6 (MTRR 66-Re): 5'GAAGATCTGCAGAAAATCCATG3'

[0074] Primer 7 (GUSB-Fo): 5'GATGTTCACTGAAGAGTACCAGAAA3'

[0075] Primer 8 (GUSB-Re): 5'CCACGTATTTTCTGCGTTTTTG3'

[0076] Probe 1 (MTHFR 677T-Pr): FAM-ATGATGAAATCGACTCCCGCAGAC-BHQ1

[0077] Probe 2 (MTHFR 677C-Pr): HEX-ATGATGAAATCGGCTCCCGCAGAC-BHQ1

[0078] Probe 3 (MTHFR 1298C-Pr): FAM-CTTCAAAGACACTTGTCTTCACTGGTCAGC-BHQ1

[0079] Probe 4 (MTHFR 1298A-Pr): HEX-CTTCAAAGACACTTTTCTTCACTGGTCAGC...

Embodiment 2

[0090] Using the kit of Example 1 of the present invention to detect human MTHFR and MTRR gene polymorphisms comprises the following steps:

[0091] (1) Processing of samples to be tested and extraction of templates;

[0092] 75 people were randomly selected to draw peripheral blood according to medical routines with informed consent, and DNA was extracted with an extraction kit, and the extracted DNA stock solution was used as a template for PCR detection.

[0093] (2) System preparation

[0094] Thaw all components in the kit on ice, and calculate and prepare each reaction mixture (see Table 1) according to the number of samples to be tested.

[0095] Table 1 detection reaction solution preparation formula

[0096]

[0097] (3) PCR amplification, the program is shown in Table 2

[0098] Table 2: PCR Amplification Procedure

[0099]

[0100]

[0101] Result analysis

[0102] Threshold value setting: set the threshold value according to different models, and dete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a kit used for detecting human MTHFR and MTRR gene polymorphism, and a detection method thereof. The kit is used for avoiding defects and insufficient in conventional gene polymorphism detection technology. A primer and a probe used for detecting MTHFR and MTRR gene polymorphism are provided; the primer and the probe can be used for detecting MTHFR gene 677C>T and 1298A>C site and MTRR gene 66A>G site polymorphism, and are high in sensitivity and specificity. The kit can be used for rapid, high efficiency, and accurate detection of human MTHFR gene 677C>T and 1298A>C site and MTRR gene 66A>G site polymorphism. The invention also provides the detection method used for detecting human MTHFR and MTRR gene polymorphism using the kit. The detection method is convenient inoperation, high in sensitivity and specificity, wide in suitable machine type range, real and reliable in detection results, and is convenient for popularization.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a kit for detecting human MTHFR and MTRR gene polymorphisms and a detection method thereof. Background technique [0002] Folic acid is a glutamic acid containing a pteridine ring. It is a B-family water-soluble vitamin that cannot be synthesized by the human body and needs to be ingested through food. It is called vitamin M, vitamin Bc or vitamin B9. It is H.K.Mitchell , 1941) extracted and purified from spinach, so it was named folic acid. Folic acid is an important substance in cell growth, differentiation, repair and host defense, and it is an indispensable nutrient in the process of embryonic development. Folic acid deficiency or metabolic disorders can lead to interference in DNA biosynthesis and in vivo methylation levels, leading to disease. Folic acid is an indispensable nutrient for fetal growth and development. Folic acid deficiency in pregnant women may lead to low birth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 杨欢欢陈正涛李兴民
Owner SHUWEN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap