DNA element for high-throughput in vitro protein synthesis

A protein synthesis and exogenous protein technology, applied in the field of DNA elements, can solve the problems of increasing the time required for protein synthesis, limiting protein production, and low protein translation efficiency

Inactive Publication Date: 2018-12-18
KANGMA SHANGHAI BIOTECH LTD
View PDF4 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these elements are often inefficient at initiating protein translation, increasing the time required for protein synthesis and limiting the final protein yield [4]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA element for high-throughput in vitro protein synthesis

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0089] In the present invention, the preparation method of the yeast cell extract is not limited, and a preferred preparation method includes the following steps:

[0090] (i) providing yeast cells;

[0091] (ii) washing the yeast cells to obtain washed yeast cells;

[0092] (iii) subjecting the washed yeast cells to destructive treatment to obtain crude yeast extract;

[0093] (iv) performing solid-liquid separation on the crude yeast extract to obtain the liquid part, which is the yeast cell extract.

[0094] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0095] In a preferred embodiment, said centrifugation is performed in a liquid state.

[0096] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000×g, preferably 8000-30000×g.

[0097] In the present invention, the centrifugation time is not parti...

Embodiment 1

[0166] Example 1: Kluyveromyces lactis-specific Kozak sequence analysis

[0167] 1.1 Determination of the specific Kozak sequence of Kluyveromyces lactis: According to the method for analyzing the specific Kozak sequence of Saccharomyces cerevisiae, the mRNA sequences of 107 genes of Kluyveromyces lactis were retrieved and collected, and the screened The 60-base sequence of the 5' end of the Kluyveromyces lactis mRNA translation initiation codon AUG and a codon sequence downstream of the 3' end were analyzed for the content of A, U, C and G, and it was unexpectedly found at the 5' end of AUG In terms of position, the proportion of adenine A is dominant, and a serine codon UCU is dominant at the 3' end of AUG, so that the specific Kozak sequence of Kluyveromyces lactis is preliminarily determined, named kl-Kozak sequence.

[0168] 1.2 Construction of yeast in vitro protein synthesis system plasmid containing Kl-Kozak sequence specific for K. lactis: In the original yeast in vi...

Embodiment 2

[0173] Example 2: Application of kl-Kozak sequence in yeast in vitro protein synthesis system

[0174] 2.1 Using the PCR method, and using primers T7_pET21a_F: CGCGAAATTAATACGACTCACTATAGG (SEQ ID NO.: 17) and T7ter_pET21a_R: TCCGGATATAGTTCCCTCCTTTCAG (SEQ ID NO.: 18) to convert the plasmids pKL-Ω-10A / 8A / 6A-Fluc and pKL-Ω- The fragments of Fluc including Ω-10A / 8A / 6A-Fluc and Ω-Fluc fragments located between the T7 transcription initiation sequence and termination sequence were amplified.

[0175] Purify and enrich the amplified DNA fragments by ethanol precipitation: add 1 / 10 volume of 3M sodium acetate (pH5.2) to the PCR product, and then add 2.5-3 times the volume (the volume is Add 95% ethanol (volume after sodium acetate) and incubate on ice for 15 min; centrifuge at a speed higher than 14000 g for 30 min at room temperature, discard the supernatant; wash with 70% ethanol, then centrifuge for 15 min, discard Discard the supernatant, dissolve the precipitate with ultrapure ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA element for high-throughput in vitro protein synthesis, and specifically discloses a novel DNA element capable of greatly enhancing protein translation efficiency. According to the present invention, with the application of the DNA element in a yeast in-vitro protein synthesis system, the relative light unit value of the activity of the synthesized luciferase is enhanced by about 22.3 times compared to the DNA element containing only the omega sequence.

Description

technical field [0001] The invention relates to the field of biotechnology, preferably, a DNA element for high-throughput in vitro protein synthesis. Background technique [0002] In eukaryotic cells, most of the mRNA molecules used to encode proteins contain a "cap" structure at the 5' end (m 7 GpppN) and the polyadenosine chain [poly(A)] structure at the 3' end. These two structures not only enhance the stability of mRNA molecules, but are also required for protein translation [1] . Among them, the 5' "cap" structure can be recognized by the translation initiation factor eIF4E, and recruit various translation initiation factors and ribosomes downstream, thereby initiating the protein translation process [1] . The "capping" of mRNA in eukaryotic cells involves a 3-step reaction catalyzed by 3 enzymes, and this process is carried out simultaneously with transcription catalyzed by RNA polymerase II [2] . [0003] In the in vitro protein synthesis system coupled with tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12P21/00C07K14/00C07K14/435C07K14/47C07K16/00C12N9/02C12N9/08C12N9/12
CPCC12N15/81C07K14/00C07K14/43595C07K14/4716C07K16/00C12N9/0008C12N9/0065C12N9/0069C12N9/12C12Y102/01009C12Y111/01006C12Y113/12007
Inventor郭敏王海鹏柴智刘帅龙于雪
OwnerKANGMA SHANGHAI BIOTECH LTD