A construction method, kit and application of an animal model of optic atrophy

A technology of optic atrophy and animal models, applied in biochemical equipment and methods, animal/human peptides, chemical instruments and methods, etc., can solve the problems of lack of animal models of optic atrophy, achieve rich categories, promote research and development, and model building short time effect

Active Publication Date: 2021-02-02
EAST CHINA NORMAL UNIV +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although there are dozens of pathogenic genes that cause hereditary optic atrophy due to mutations, the existing animal models are only OPA1 (Q285STOP) mice and OPA3 (L122P) mice induced by ENU
Although phenotypically able to mimic the symptoms of hereditary optic atrophy, most of them are recessive genetic diseases, lacking animal models of dominantly inherited optic atrophy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A construction method, kit and application of an animal model of optic atrophy
  • A construction method, kit and application of an animal model of optic atrophy
  • A construction method, kit and application of an animal model of optic atrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0045] In this embodiment, mice are taken as an example to illustrate the method for constructing the mouse model of optic atrophy in this embodiment. The specific operation is as follows:

[0046] (1) Using the CRISPR design tool (online design tool http: / / tools.genome-engineering.org), select the CRISPR / Cas system knockout target, that is, the 18bp DNA ending with NGG as the target sequence: CATCTTCATTGTGGG CGG (5'-3'); the underline is the position of the PAM motif.

[0047] (2) For the above-mentioned target, an oligonucleotide chain with a T7 promoter sequence and a 60bp target sequence (ie, the sgRNA precursor sequence) synthesized in vitro, the sequence of the sgRNA precursor sequence is as follows:

[0048] GATCACTAATACGACTCACTATAGG CATCTTCATTGTGGGCGG GTTTTAGAGCTAGAAAT; target sequence is underlined.

[0049] (a) Using this as a template, perform PCR reaction with high-fidelity KOD enzyme to obtain a DNA template that can transcribe sgRNA.

[0050] PCR reaction s...

experiment example

[0074] Phenotypic Characterization of a Mouse Animal Model of Optic Atrophy

[0075] (1) Measurement of visual evoked potential (VEP)

[0076] Take the mice under the natural light adaptation state, respectively connect the recording electrode to the cheek, the reference electrode to the cranium, and the ground electrode to the tail, and use the visual electrophysiological recorder (VEP) to measure the visual evoked potential, and detect the waveform (N1 wave and P1 wave ) is abnormal.

[0077] The result is as figure 2 As shown, heterozygous OPA3 G93S / + and homozygous OPA3 G93S / G93S Both animal models showed abnormal visual evoked potential (VEP), and the amplitude difference between N1 wave and P1 wave decreased.

[0078] (2) Ex vivo tissue detection: After the mice were sacrificed, the eyeball and optic nerve were bluntly separated, the scissors went deep into the deep orbit, cut off the optic nerve, and the eyeball and optic nerve were taken out.

[0079] (a) Retinal...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method, kit and application of an animal model of optic atrophy. Involved in the field of biotechnology. In the construction method, the base at the 277th position of exon 2 of the animal OPA3 gene is mutated from G to A, and then the 93rd position of the encoded OPA3 protein is mutated, and the amino acid residue G is mutated into S; Animals containing this mutation exhibit typical optic atrophy disease characteristics and can be used as an animal model of optic atrophy; this animal model fills the lack of current animal models of autosomal dominant autosomal dominant optic atrophy and enriches the existing animal models of optic atrophy category, which is conducive to promoting the research and development of ophthalmic diseases.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a construction method, kit and application of an animal model of optic atrophy. Background technique [0002] The human OPA3 gene is located at 19q13.32, and the OPA3 protein encoded by it is one of the mitochondrial fusion proteins. This gene has multiple mutation sites, such as IVS1-1G-C, 18-BP DEL, and 313C-G(Q105E). The first two mutations lead to clinical disease type III 3-methylglutaconic aciduria, manifested as symptoms of central nervous system diseases such as rigidity, ataxia, and cognitive impairment, and are autosomal recessive genetic diseases; the third This mutation causes optic atrophy with or without cataracts and mild neurological symptoms, and is an autosomal dominant genetic disease. [0003] Although there are dozens of pathogenic genes that cause hereditary optic atrophy due to mutations, the existing animal models are only OPA1 (Q285STOP) mice and OPA3 (L122...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/85A01K67/027
CPCA01K67/0275A01K2267/03C07K14/47C12N2800/80C12N2810/10
Inventor田颖李大力刘明耀邵艳姣尹树明席在喜
OwnerEAST CHINA NORMAL UNIV