The Characteristic Sequence, Marker Primer and Identification Method of Thin-shelled Pecan Variety Osage

Abstract

The invention relates to multiple pairs of high-specificity characteristic sequences of the pecan variety Osage, molecular specific marker primers, and a method capable of rapidly and accurately identifying the pecan variety Osage. The sequence of the molecule-specific marker primer set is as follows: 1) Upstream primer: 5′-GCAGGCTTCAATGCAACACA-3′ Downstream primer: 5′-TGTCAGCGAACCCTCTCAAC-3′ 2) Upstream primer: 5′-AGGCAAGGATAATCGTGGCA-3′ Downstream primer: 5′ ‑CCACCAACCCAAGATGTCGA‑3′3) Upstream primer: 5′‑TCGCAGCAACAAACAACATTCA‑3′ Downstream primer: 5′‑GGGACATTCTTCCAAGGGGT‑3′ Molecularly specific marker primers of the present invention can quickly and early identify the thin-shell hickory variety Osage, and the method is simple , quick and accurate, it is an irreplaceable molecular method for distinguishing pecan varieties with thin shells by appearance characteristics.

Description

technical field [0001] The invention relates to a characteristic sequence of the pecan variety Osage, a molecular specific marker primer combination and a method for specifically identifying the pecan variety Osage by using the molecular specific marker primer combination. Background technique [0002] Carya illinoënsis (Wangenh.) K.Koch) is the most economically valuable tree species in the genus Carya illinoënsis (Wangenh.) K. Koch; Carya illinoënsis is a typical outcross plant. The variety configuration of pecans is one of the main factors affecting its yield; the United States is one of the origins of pecans, and it is also the central production area. Over the years, the United States has selected and named about 1,000 cultivars; Walnut has a history of more than 100 years, and there are dozens of varieties commonly used in production at present. Years of production practice have proved that the vast subtropical regions of my country are the suitable growth areas for thin...

AI Technical Summary

Problems solved by technology

[0003] However, the main problem faced by the existing pecan production areas in my country is the low and unstable yield. There are many reasons for this phenomenon, one of which is the lack of clear genetic relationship analysis of the existing introduced varieties. Coupled with the confusion of the naming of some hybrid offspring, it is difficult to carry out effective parent selection and rational allocation, and it is not convenient for variety identification, promotion, communication and cultivation of new varieties. Therefore, efforts have been made to develop some stable and specific DNA varieties at the molecular level. Fingerprint marking is a scientific way to realize accurate and rapid identification of pecan varieties;

[0004] Some molecular marker methods have been reported at home and abroad for the identification and kinship analysis of pecan varieties. The SSR molecular marker method is better, but these old detection methods are cumbersome and the results are unstable.

Images