Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau-1B-1 and application thereof

A technology of qyr.sicau-1b.1 and molecular markers, which is applied in the fields of molecular biology and crop genetics and breeding, can solve the problems of inability to carry out photosynthesis, grain failure, necrotic spots, etc., so as to improve the efficiency of breeding work and improve selection The effect of high identification efficiency and accuracy

Active Publication Date: 2019-05-03
SICHUAN AGRI UNIV
View PDF3 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Wheat stripe rust is an important disease in my country's wheat production. When it is attacked by stripe rust, yellow necrotic spots will appear on wheat leaves, and yellow uredia will be produced, and these spores will turn black in the later stage; Stripe rust will cause the leaves to chlorotic, unable to carry out photosynthesis, thereby reducing yield, and even cause no harvest in severe cases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau-1B-1 and application thereof
  • SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau-1B-1 and application thereof
  • SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau-1B-1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Obtaining of Wheat Stripe Rust Resistance Gene QYr.sicau-1B-1 and Its Molecular Marker KASP-Yr

[0044] (1) Using the wheat line '20828' as the female parent and the wheat variety 'CN16' as the male parent, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 199 lines were obtained to form a genetic mapping population.

[0045] (2) Identification of stripe rust phenotype in the recombinant inbred line population. When the induced material SY95-71 is fully morbid, the disease resistance response of the test material is recorded in the field, and the response type is classified according to the 1-9 classification standard for each strain in the population. Judgment was carried out, and the judgment result was recorded as the morphological marker data of the stripe rust resistance gene QYr.sicau-1B.1. In this way, the location located on the linkage map is the locatio...

Embodiment 2

[0052] Example 2 Application of Molecular Marker KASP-Yr in Selection and Control of Stripe Rust Resistance QTL QYr.sicau-1B.1

[0053] (1) The common wheat line '20828' resistant to stripe rust was used as the female parent, and the common wheat line 'SY95-71' susceptible to the disease was used as the male parent to construct recombinant inbred lines, and 163 lines were randomly selected from the offspring lines.

[0054] (2) Carry out KASP-Yr marker detection on the obtained 163 strains, the specific method is: extract the DNA of 163 strains; use it as a template, and perform PCR with the specific primer pair of molecular marker KASP-Yr as primers Amplify and carry out fluorescence reading value, described labeled KASP-Yr primer is:

[0055] Primers on the FAM tag: (the underlined part is the FAM tag sequence)

[0056] 5'- GAAGGTGACCAAGTTCATGCT CTTGTGTGTGACTGTACCATA-3' (SEQ ID No. 1)

[0057] Primers on the HEX tag: (the underlined part is the HEX tag sequence)

[0058...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular breeding, and provides an SNP molecular marker linked with a wheat stripe rust resistance gene QYr.sicau-1B.1 and application thereof. The SNPmolecular marker is KASP-Yr, which can be obtained by amplifying a primer having a nucleotide sequence as shown in SEQ ID NO.1-3. Detection analysis indicates that the molecular marker can be used for accurately tracking wheat stripe rust resistant QTL QYr.sicau-1B.1 and predicting the stripe rust resistance characteristics of wheat, so that molecular designed breeding can be performance conveniently. The invention further discloses a method for identifying the molecular marker linked with wheat stripe rust resistance QTL QYr.sicau-1B.1. By utilizing the method, the stripe rust resistance prediction accuracy can be reinforced to quickly screen wheat variety or strain with stripe rust resistance for breeding, the breeding process for high-yield variety of wheat can be greatly accelerated.

Description

technical field [0001] The present invention relates to the fields of molecular biology and crop genetics and breeding, in particular to molecular markers related to wheat stripe rust resistance traits, specifically to SNP molecular markers linked to wheat stripe rust resistance gene QYr. The primer pair and the application of the molecular marker. Background technique [0002] Wheat is an important grain crop in my country, with an annual planting area of ​​more than 20 million hectares, accounting for about 27% of the grain crop area; a total output of more than 100 million tons, accounting for about 22% of the grain crop output. Wheat stripe rust is an important disease in my country's wheat production. When it is attacked by stripe rust, yellow necrotic spots will appear on wheat leaves, and yellow uredia will be produced, and these spores will turn black in the later stage; Stripe rust can cause leaves to chlorotic, unable to carry out photosynthesis, thereby reducing y...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6851C12N15/11
Inventor 马建兰秀锦秦娜娜郑有良魏育明江千涛陈国跃刘亚西
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com