Check patentability & draft patents in minutes with Patsnap Eureka AI!

RAA primer probe for detecting Nipah viruses as well as detection method

A Nipah virus and probe technology, which is applied in the field of primers, probes and detection of Nipah virus by RAA fluorescence method, can solve the problems of difficulty in applying large-scale screening, inconvenient operation, and high personnel requirements, and achieve convenience, speed and accuracy Identification, easy operation, and the effect of reducing detection time

Pending Publication Date: 2019-12-20
CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT +1
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the fluorescent PCR method still has the problems of expensive and huge equipment, high requirements for experimental sites and personnel, and it is difficult to apply to large-scale on-site screening. The detection time is too long, and it takes 1 to 2 hours
[0019] Therefore, based on the shortcomings of the existing detection technology such as long time, inconvenient operation, and high false positives, it is urgent for those skilled in the art to provide an accurate, sensitive, easy-to-operate RAA fluorescence method suitable for rapid on-site detection of NiV. question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RAA primer probe for detecting Nipah viruses as well as detection method
  • RAA primer probe for detecting Nipah viruses as well as detection method
  • RAA primer probe for detecting Nipah viruses as well as detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1 selects Nipah virus N gene conservative sequence to carry out primer, probe design

[0054] Find the corresponding full gene sequence in Genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and Blast sequence analysis, and screen out the highly conserved sequence of the N gene of Nipah virus as follows:

[0055] CAGCCGAGCTTACGGCCTACGGATAACAGACATGAGCACCCTGGTCTCTGCAGTTATCACCATCGAGGCCCAGATCTGGATACTGATCGCTAAAGCAGTTACAGCTCCCGACACTGCCGAGGAAAGTGAAACTAGAAGATGGGCTAAATACGTCCAACAAAAGAGAGTCAATCCGTTCTTTGCTCTAACTCAGCAATGGCTAACAGAAATGAGGAATCTGCTCTCCCAGAGTCTATCAGTAAGGAAGTTCATGGTTGAGATCCTCATAGAAGTCAAGAAAGGAGGATCTGCTAAAGGCAGAGCAGTAGAAATAATCTCAGACATCGG(SEQ ID NO.1);

[0056] The highly conserved sequence obtained by screening was used as the target gene fragment for detection, and positive plasmids were synthesized, and primers and probes were designed and screened for detection.

[0057] According to the above conserved sequence of Nipah virus N gene, ...

Embodiment 2

[0089] Embodiment 2 primer probe concentration screening

[0090] (1) Primer

[0091] Upstream primer: 5'-CTAAAGCAGTTACAGTCCCGACACTGCCG-3'; SEQ ID NO.4

[0092] Downstream primer: 5'-CCGATGTCTGAGATTATTTTTACTGCTCTGCC-3'; SEQ ID NO.6

[0093] (2) Probe

[0094] The probe sequence is:

[0095] 5'-CAGAAATGAGGAATCTGCTCTCCCAGAGTCTATCAGTAAGGAAGTTCATG'; SEQ ID NO.8.

[0096] The probe is modified with a fluorescent reporter group (FAM) and a fluorescent quencher group (BHQ1);

[0097] The modified probe is: CAGAAATGAGGAATCTGCTCTCCCAGAGTC / i6FAM dT / / idSp / / iBHQ1dT / CAGTAAGGAAGTTCATG.

[0098] (3) Prepare primer probes of different concentrations, as shown in Table 3:

[0099] Table 3 Primer probe concentration list

[0100] Concentration 1 Concentration 2 Concentration 3 Concentration 4 Concentration 5 F 1μM 5μM 10μM 20μM 50μM R 1μM 5μM 10μM 20μM 50μM P 1μM 5μM 10μM 20μM 50μM

[0101] (4) Implementation method of pr...

Embodiment 3

[0114] A kind of method that RAA fluorescence method detects Nipah virus, comprises the steps:

[0115] (1) Construct a recombinant plasmid containing the target gene fragment, and obtain a plasmid extract.

[0116] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 for preheating, and set the reaction parameters. The reaction parameters are set to 39°C, and the reaction time is 12 minutes;

[0117] (3) Add 13.7 μL of water to 25 μL of reaction buffer, 2.1 μL of upstream and downstream primers and 0.6 μL of probe at a concentration of 10 μM, mix well, add to RAA fluorescent basic reaction reagent and mix to obtain a reaction master mix;

[0118] (4) Add 2.5 μL of Mg to the cap of the reaction tube + , fully mixing 4 μL of the nucleic acid extraction solution obtained in the step (1) with the reaction premix solution obtained in the step (3), and putting the obtained reaction system into a constant temperature fluorescent gene detector RAA-F1620 to detect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and a probe for detecting Nipah viruses by an RAA fluorescence method as well as a detection method, wherein the primer and the probe are suitable for RAA fluorescencemethod detection, Nipah virus plasmid can be detected, cross reaction with Hendra virus plasmid, foot and mouth disease viruses, porcine parvoviruses, pseudorabies viruses, porcine circoviruses, epidemic type b encephalitis viruses, reproductive and respiratory syndrome viruses, hog cholera viruses and infectious gastroenteritis viruses can be avoided, and the specificity reaches to 100 percent;the detection method is rapid, high flux is easy to realize, the detection time and the detection cost are reduced; and according to the method for rapidly detecting Nipah virus DNA based on the RAA fluorescence method, the sensitivity is high, and 74 copies / reaction is realized under the probability that the reaction detection sensitivity is 95 percent.

Description

technical field [0001] The invention belongs to the technical field of virus detection, and in particular relates to a primer probe and a detection method for detecting Nipah virus by RAA fluorescence method. Background technique [0002] Nipah virus disease (NVD) is a severe zoonotic disease caused by Nipah virus (NiV), which can infect bats, pigs, cats, dogs, horses, rats, and humans under natural conditions. . Fruit bats are the natural host of the virus, and humans can be infected through natural contact with fruit bats or contact with intermediate hosts such as pigs. The virus and Hendra virus belong to the Paramyxoviridae Hendra Nipah virus genus. In recent years, the disease has frequently appeared in some Southeast Asian countries such as Malaysia, Bangladesh, and India, which has aroused great concern. According to statistics, from 1998 to 2015, more than 600 cases of Nipah virus infection were reported worldwide. According to the official website of the World H...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2563/107C12Q2521/507C12Q2522/101
Inventor 吴晓东樊晓旭赵洋蔡禹希郭利川应清界李林赵永刚朱琳王志亮
Owner CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More