Modified yeast comprising glucose-specific, ATP-mediated transporters

A technology for transporting proteins and glucose, applied in fermentation, biofuels, peptide sources, etc., can solve problems such as reducing cell robustness

Inactive Publication Date: 2020-04-24
DANISCO US INC
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the challenge of introducing such non-stoichiometric ATP depletion, especially for industrial applications, is to fine-tune the positive effects with reduced cellular robustness (Gombert and van Maris, supra)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified yeast comprising glucose-specific, ATP-mediated transporters
  • Modified yeast comprising glucose-specific, ATP-mediated transporters
  • Modified yeast comprising glucose-specific, ATP-mediated transporters

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0111] Materials and Methods

[0112] Liquefaction preparation:

[0113] The liquefied product (corn flour slurry) was added by adding 600ppm urea, 0.124SAPU / g ds FERMGEN TM (Acid fungal protease) 2.5x, 0.33 GAU / g ds TrGA (Trichoderma glucoamylase) and 1.46 SSU / g dsAKAA (Aspergillus alpha-amylase), adjusted to pH 5.4.

[0114] Serum Bottle Assay:

[0115] Yeast cells were inoculated into 2 mL of YPD in a 24-well plate, and the culture was grown overnight to an OD between 25-30. 2.5 mL of liquefied fluid was transferred to serum vials (Chemglass, Cat. No.: CG-4904-01 ), and yeast was added to each vial to a final OD of approximately 0.4-0.6. Install the cap of the vial and pierce it with a needle (BD, Cat. No. 305111) for ventilation (to release CO 2 ), and then incubated at 32°C for 65 hours with shaking at 200RPM.

[0116] AnKom assay:

[0117] 300 μL of the concentrated overnight yeast culture was added to each of multiple ANKOM bottles filled with 50 g of the prepared...

example 2

[0121] Constructs for overexpression of codon-optimized, glucose-specific, ATP-mediated transporter The gene for glucose-specific, ATP-mediated transporter 9 (AtSTP9) from Arabidopsis thaliana was codon-optimized and then synthesized as Generate AtSTP9S. The nucleotide and amino acid sequences of AtSTP9S and its expression product AtSTP9S are shown as the following SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0122] Nucleotide sequence of AtSTP9S gene (SEQ ID NO: 1):

[0123] ATGGCTGGTGGTGCCTTTGTCTCCGAAGGTGGCGGTGGAGGCAACTCTTACGAAGGTGGCGTTACCGTCTTTGTTATCATGACCTGTATTGTTGCCGCTATGGGAGGTTTGCTATTTGGTTACGACTTGGGTATCTCTGGCGGTGTCACCTCTATGGAAGAGTTCTTGTCCAAGTTTTTCCCAGAAGTTGACAGACAAATGCACGAAGCCAGACGTGAAACTGCTTACTGCAAGTTCGATAACCAATTGCTACAATTGTTCACCTCTTCCTTGTACTTGGCTGCCTTAGTCTCTTCCTTTGTTGCTTCTGCTGTCACCAGAAAGTACGGTAGAAAGATTTCCATGTTTGTTGGTGGCGTCGCTTTCTTGATCGGTTCTTTGTTCAACGCCTTTGCTACCAACGTTGCTATGTTGATCATTGGTAGATTGCTATTGGGTGTCGGCGTCGGTTTTGCTAATCAATCTACTCCAGTTTACTTGTCCGAAATGGCTCCAGCCAAGATCAGAG...

example 3

[0136] Generation of yeast strains expressing glucose-specific, ATP-mediated transporters

[0137] Will The GOLD yeast strain (Martrex, Inc., MD, USA; referred to herein as "FG") was used as a parental strain to introduce the AtSTP9S expression cassette. With containing from the plasmid pZK41Wn-H3SP9 ( figure 2 The 2,949bp SwaI fragment of the AtSTP9S expression cassette of ) and the plasmid pYRH426 transformed the cells. A transformant that integrated the SwaI fragment from pZK41Wn-H3SP9 downstream of the YHL041W locus was selected and named strain G027.

[0138] The new FG yeast strain G027 was grown in vial cultures together with its parental strain FG, and its fermentation products were analyzed as described in Example 1. Properties for ethanol, glycerol and acetic acid production are shown in Table 3.

[0139] Table 3. Comparison of FG and G027 in vial assays

[0140]

[0141] Strain G027 produced approximately 2% more ethanol than the parental strain and produc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Described are compositions and methods relating to modified yeast expressing exogenous, or increased amounts, of glucose-specific, ATP-mediated transporters. The modified yeast produces an increased amount of ethanol compared to parental cells. Such yeast is particularly useful for large-scale ethanol production from starch substrates.

Description

technical field [0001] The compositions and methods of the invention relate to modified yeast with glucose-specific, ATP-mediated transporters. The modified yeast produces increased amounts of ethanol in starch hydrolyzate fermentation compared to an otherwise identical yeast. This yeast is particularly useful for the large-scale production of ethanol from starch substrates. Background technique [0002] The first generation of yeast-based ethanol production converts sugar into fuel ethanol. The annual fuel ethanol production by yeast worldwide is about 90 billion liters (Gombert, A.K. and van Maris. A.J. (2015) Curr. Opin. Biotechnol. 33:81-86). It is estimated that approximately 70% of the cost of ethanol production is feedstock. Because the production volumes are so large, even a small increase in yield would have a huge economic impact on the industry. [0003] Biochemically, the conversion of glucose to ethanol and carbon dioxide is redox-neutral with a maximum theo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12P7/06
CPCC07K14/415C12P7/06Y02E50/10
Inventor D·J·马库尔Y·J·王P·J·M·特尼森Q·Q·朱
Owner DANISCO US INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap