Method for removing drug-resistant plasmids in enterobacteriaceae bacteria
An Enterobacteriaceae bacteria and plasmid technology, applied in the field of gene editing, can solve the problems of inapplicable clinical isolates, lack of specificity in plasmid removal, bacterial chromosome mutation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] A method for removing drug-resistant plasmids in Enterobacteriaceae bacteria, comprising the following steps:
[0032] (1) Drug-resistant gene information mining: Search and download all blaKPC and blaNDM gene sequences in genbank through NCBI, and use blast to compare the gene sequences to find the consensus sequence of 20 bases next to the PAM motif As a target for the elimination of drug resistance genes;
[0033] The 20-base consensus sequence next to the PAM motif adopts the targeting sequence of the drug-resistant plasmid.
[0034] (2) In step S1, the gene sequence is connected to the gRNA: the targeted sgRNA gene fragment is generated by artificially synthesizing primers and PCR.
[0035] (3) Construct the crispr / cas9 tool plasmids pCureKPC and pCureNDM containing the targeting sequence in the above S1 step.
[0036] (4), replace the resistance markers of pCureKPC and pCureNDM plasmids.
[0037] (5), drug susceptibility test of cre bacterial strain: Utilize di...
Embodiment 2
[0047] 1. Construction of tool plasmids for eliminating drug-resistant genes in Enterobacteriaceae
[0048]Target sequence design: According to the basic requirements of CRISPR technology, the guide RNA recognition sequence should have a complementary sequence of 20 bases to the gene to be edited, and this sequence should be adjacent to the PAM motif called NGG. Retrieve and download all blaKPC and blaNDM gene sequences in genbank through NCBI, and use blast to compare each gene sequence to find the target of drug-resistant gene elimination. The results are as follows:
[0049] N20-KPC: CAATTTGTTGCTGAAGGAGT
[0050] N20-NDM: CCCAACGGTGATATTGTCAC
[0051] 2. The target sequence is inserted into the pSGKp-arr plasmid and gRNA is connected
[0052] Synthesize primers based on the target sequence:
[0053] name sequence F-KPC AATACTAGT CAATTTGTTGCTGAAGGAGT GTTTTAGAGCTAGAAATAGC F-NDM AATACTAGT CCCAACGGTGATATTGTCAC GTTTTAGAGCTAGAAATAGC R1 GCCGC TCT...
Embodiment 3
[0087] Explore the best arabinose induction concentration and induction time
[0088] 1. The overnight culture of the strain containing the pCure-arr-KPC plasmid was diluted 1000 times in 5 ml of LB broth containing 0.2% arabinose and 100 ug / mL rifampicin. Arabinose was induced for 0, 2, 4, 6, and 16 hours, respectively, and then the cultures were inoculated on double antibody plates containing doripenem / rifampicin and monoclonal antibody plates on LB agar containing rifampicin, and the concentration of doripenem was determined. The colony ratio of Nan / rifampicin double-antibody plate and rifampin antibody plate was used to calculate the clearance rate.
[0089] 2. In order to evaluate the optimal arabinose concentration, the overnight culture of the strain carrying the pCure-arr-KPC plasmid was diluted 1000 times in 5 ml of LB medium containing 0.02%, 0.2%, 2% arabinose, and incubated at 37°C Growth with shaking (250 rpm)) for 6 hours. Cultures were diluted and plated on LB...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More