A method for constructing a universal gene detection library for alport syndrome and its kit
A technology of gene detection and library construction, applied in the field of gene detection, can solve the problems of clinical application limitations, library incompatibility, and sequencing data generation, and achieve the effects of avoiding false positives, realizing authenticity interpretation, and overcoming label jumping
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 Design and preparation of universal high-throughput sequencing adapters
[0059] Based on the applicant's previous patent application CN202010407833.5, a universal sequencing linker sequence that can be used for genes such as COL4A3, COL4A4, COL4A5, COL4A6, and MYH9, and is also applicable to Ion Torrent and Illumina multi-sequencing platforms was designed and prepared. The specific method is as follows:
[0060] according to figure 1 The composition of the linker assembly shown is to design 10 sets of universal high-throughput sequencing linker AN1 / PN1-AN10 / PN10 for the full coding region and variable splicing region of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9 genes, which have:
[0061] First synthesize the following single strand
[0062] sequence a:
[0063] 5'-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCCGT-3';
[0064] Sequence b:
[0065] 5'-GAACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3...
Embodiment 2
[0079] Example 2 Construction of a universal gene detection library for Alport syndrome
[0080] Collect 10 samples from patients with Alport syndrome in Peking Union Medical College Hospital for library construction, using the full coding region and variable splicing region (20bp extension from exon to intron) of COL4A3, COL4A4, COL4A5, COL4A6 and MYH9 genes As the primer pool of the target region, perform multiple reaction PCR, and connect the sequencing adapter to construct the library. The specific operation process is as follows:
[0081] (1) Nucleic acid extraction and quality inspection: after blood cells undergo nucleic acid extraction and quality inspection, they are required to meet certain quality control standards: DNA concentration: 10ng / μL; DNA purity: OD260 / 280 1.8-2.0, OD260 / 230>2; DNA Total starting amount: 20ng.
[0082] (2) Multiplex PCR primer design and amplification:
[0083] Design a primer pool based on the full coding region of COL4A3, COL4A4, COL4A5...
Embodiment 3
[0091] Example 3 Multi-platform sequencing verification and detection
[0092] Combined with the high-throughput sequencing platform Ion GeneStudio TM The S5 Plus platform and the Miseq DX platform perform DNA sequencing, and then detect point mutations (SNP) and small fragment insertion-deletion (InDel). The specific steps are as follows:
[0093] (1) After purification, the library was quality checked and quantified using Agilent 2100 and QUBIT 4.0. Library 2100 quality control map see Figure 2-3 , showing that the main peak of the library length fragment is around 400bp and the main peak of the library is a single sharp single peak. The results indicate that the two ends of the target gene fragment have been connected with universal high-throughput sequencing adapters. The library concentration was calculated according to the dilution factor. If the library concentration is higher than 1ng / uL, the subsequent experimental steps can be performed, and if the library concent...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



