A method for constructing a universal gene detection library for hereditary familial hypercholesterolemia and its kit
A hypercholesterolemia and genetic detection technology, applied in the field of genetic detection, can solve the problems of uncommon libraries and clinical application limitations, and achieve the effect of avoiding false positives and overcoming label jumping
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 Design and preparation of universal high-throughput sequencing adapters
[0059] Based on the applicant's previous patent application CN202010407833.5, a universal sequencing linker sequence that can be used for LDLR, APOB, PCSK9 and LDLRAP1 genes, and is also suitable for Ion Torrent and Illumina multi-sequencing platforms is designed and prepared. The specific method is as follows:
[0060] according to figure 1 The composition of the linker assembly shown is to design 10 sets of universal high-throughput sequencing linker AN1 / PN1-AN10 / PN10 for the entire coding region and variable splicing region of LDLR, APOB, PCSK9 and LDLRAP1 genes, which have:
[0061] First synthesize the following single strand
[0062] sequence a:
[0063] 5'- XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTC CAGTCACXXXXXXATCTCGTATGCCGTCTTCTG-3';
[0064] Sequence b:
[0065] 5'-ACACCGAGATTCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3';
[0066] Sequence ...
Embodiment 2
[0080] Example 2 Construction of Universal Gene Detection Library for Hereditary Familial Hypercholesterolemia
[0081] Samples from 10 patients with hereditary familial hypercholesterolemia were collected for library construction, using the entire coding region and variable splice region (20 bp extension from exon to intron) of LDLR, APOB, PCSK9 and LDLRAP1 genes as targets The primer pool in the region is subjected to multiple reaction PCR, and the sequencing adapter is connected to construct the library. The specific operation process is as follows:
[0082] (1) Nucleic acid extraction and quality inspection: after blood cells undergo nucleic acid extraction and quality inspection, they are required to meet certain quality control standards: DNA concentration: 10ng / μL; DNA purity: OD260 / 280 1.8-2.0, OD260 / 230>2; DNA Total starting amount: 20ng.
[0083] (2) Multiplex PCR primer design and amplification:
[0084] Design a primer pool based on the full coding region and var...
Embodiment 3
[0092] Example 3 Multi-platform sequencing verification and detection
[0093] Combined with the high-throughput sequencing platform Ion GeneStudio TM The S5 Plus platform and the Miseq DX platform perform DNA sequencing, and then detect point mutations (SNP) and small fragment insertion-deletion (InDel). The specific steps are as follows:
[0094] (1) After purification, the library was quality checked and quantified using Agilent 2100 and QUBIT 4.0. Library 2100 quality control map see Figure 2-3 , showing that the main peak of the library length fragment is around 400bp and the main peak of the library is a single sharp single peak. The results indicate that the two ends of the target gene fragment have been connected with universal high-throughput sequencing adapters. The library concentration was calculated according to the dilution factor. If the library concentration is higher than 1ng / uL, the subsequent experimental steps can be performed, and if the library concen...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



