Universal high-throughput sequencing adapter and application thereof

A sequencing linker and high-throughput technology, which can be used in the determination/testing of microorganisms, chemical libraries, combinatorial chemistry, etc., and can solve problems such as the inability to implement different sequencing platforms

Active Publication Date: 2020-07-31
ANNGEEN BIOTECHNOLOGY CO LTD
View PDF8 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved by the present invention is to overcome the defects that the high-throughput sequencing joints in the prior art cannot realize the compatibility and universality of different sequencing platforms, and the applicability is not strong.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Universal high-throughput sequencing adapter and application thereof
  • Universal high-throughput sequencing adapter and application thereof
  • Universal high-throughput sequencing adapter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0150] Example 1 Design and preparation of high-throughput sequencing adapters

[0151] according to figure 1 As shown in the structural composition, two sets of universal high-throughput sequencing adapters AN1 / PN1 and AN2 / PN2 were designed. Among them, AN1 / PN1 is a set of universal high-throughput sequencing adapters with short sequences, and AN2 / PN2 is another set of universal high-throughput sequencing adapters with longer sequences.

[0152] The specific preparation method is as follows:

[0153] The sequencing adapters shown in the following sequences 1-4 were prepared, the sequences 1 and 2 were annealed to form the AN1 adapter, and the sequences 3 and 4 were annealed to form the AN2 adapter.

[0154] Sequence 1:

[0155] 5'-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTA*T*G-3'; (3' free arm chain)

[0156] Sequence 2:

[0157] 5'-ACCGAGATTCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3'; (5' free arm chain)

[0158] Seq...

Embodiment 2

[0172] Example 2 General high-throughput sequencing library preparation of aorta-related genes

[0173] The universal high-throughput sequencing adapters AN1 / PN1 and AN2 / PN2 prepared in Example 1 were used for experiments.

[0174] Wherein, the number of universal high-throughput sequencing adapters corresponds to the number of samples to be tested. For example, if the number of samples to be tested is 10, 10 sets of universal high-throughput sequencing adapter sets are correspondingly prepared, and each set of universal high-throughput sequencing adapter sets includes PN1 adapters and AN1 adapters. The nucleotide sequences of the tag sequences in the same group of PN1 adapters and AN1 adapters are the same, and the base sequences of the tag sequences in different adapter groups are different.

[0175] Ligate the target fragment to be tested with the above sequencing adapter set to obtain a ligation product; wherein, the gene fragments from the same sample source are connecte...

Embodiment 3

[0202] Example 3 Sequencing analysis based on Ion Torrent platform and Illumina platform

[0203] In this example, the Ion Torrent platform and the Illumina platform were used to perform sequencing verification on the above-mentioned high-throughput library, as follows:

[0204] 1. Ion Torrent platform Ion GeneStudio TM Sequencing on the S5 Plus sequencer, the specific implementation steps are as follows:

[0205] Dilute the library after the above purification and quality inspection, using Ion 520 TM &Ion 530 TM Kit–OT, according to the kit protocol, after template preparation on the IonTouch 2 instrument, Ion GeneStudio TM Sequencing and data analysis were performed on the S5 Plus gene sequencer.

[0206]2. Sequencing on the Illumina platform Miseq DX sequencer, the specific implementation steps are as follows:

[0207] After the above-mentioned purification and quality inspection, the library was diluted, and the Miseq DX Reagent Kit v3 was used to perform sequencin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a universal high-throughput sequencing adapter and application thereof. The universal high-throughput sequencing adapter includes a double-stranded complementary region and asingle-stranded free arm. The sequencing adapter can be compatible with multiple sequencing platforms, including Ion Torrent, Illumina platforms and the like, and the universal high-throughput sequencing adapter is suitable for clinical testing and cost saving and can further be applied to the authenticity interpretation of low-frequency mutations.

Description

technical field [0001] The invention relates to the field of gene sequencing, in particular to a general-purpose high-throughput sequencing joint and its application in the process of sequencing library construction. Background technique [0002] With the development of gene sequencing technology, high-throughput sequencing technology (High-Throughput Sequencing) is more and more widely used in clinical practice, such as newborn screening for high-risk diseases, diagnosis of genetic diseases and detection of gene carrier and gene Drug testing is used in many ways to personalize drug dosing, selection, and drug response. High-Throughput Sequencing (High-Throughput Sequencing), also known as Next Generation Sequencing (NGS), is relative to traditional Sanger Sequencing. The principle of Sanger sequencing is to extend the artificially synthesized short oligonucleotide primers by DNA polymerase, hybridize with single-stranded DNA templates, synthesize new DNA fragments, and sep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6869C12Q1/6806C12Q1/6858C12N15/11C40B50/06
CPCC12Q1/6806C12Q1/6858C12Q1/6869C40B50/06C12Q2525/191C12Q2535/122C12Q2531/113
Inventor曹彦东周洋扶媛媛杨颖张丽婷
OwnerANNGEEN BIOTECHNOLOGY CO LTD