Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of MC3R gene edited porcine fibroblast line

A porcine fibrogenesis and gene editing technology, applied in the field of gene editing, can solve the problems of unclear physiological function and mechanism of action of MC3R

Active Publication Date: 2020-11-03
ZHEJIANG QINGLIAN FOOD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the physiological function and mechanism of MC3R are not clear at present, and there are only a few reports from MC3R knockout mouse models

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of MC3R gene edited porcine fibroblast line
  • Preparation method of MC3R gene edited porcine fibroblast line
  • Preparation method of MC3R gene edited porcine fibroblast line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. The construction of a MC3R gene knockout vector, comprising:

[0039] 1.1 Target design

[0040] Using the BAC sequence (CH242-163M14) of the pig chromosome 17 clone of the MC3R gene as a reference, primers were designed to amplify the MC3R gene and part of its regulatory region in large white pig cells: Genomic DNA was extracted strictly according to the instructions of QIAGEN 69506 DNeasy Blood&TissueKit (250), The following primers were designed for identification amplification: MC-F: TGCTATCGACCGGACGCCAATC; MC-R: ACTGCACTGCTCAACCTATTAC. The reaction system is: 10×LA Buffer 2μL, 2.5mM dNTPs 1.6μL, CX-F1 1μL, CX-R2 1μL, LA DNA Polymerase 0.2μL, Genomic DNA 10μL, ddH 2 O 4.2 μL. Reaction program: 94°C for 2min, 98°C for 10s, 69°C for 200s, cycle 30 times, 72°C for 10min, and store at 4°C. After the PCR reaction was completed, the product was mixed with 4 μL 6x Loding Buffer, and electrophoresed on a 1% agarose gel. After amplification, agarose gel electrophoresi...

Embodiment 2

[0079] The preparation method of the improved trypsin digestion solution is: accurately weigh 0.5g of EDTA, 1.0g of dextrose, 9.6g of PBS powder, 3.0g of Tris base, 0.3g of 2-ethyl-3-hydroxy-4-pyrone, Dissolve in 900mL of ultrapure water, adjust the pH to 7.6, then add 1g of trypsin, dissolve and dilute to 1L, filter through a 0.2μm membrane, and store at -20°C.

[0080] 2.4.2 Electric shock transfection: when the confluence of the cells is 75%, take out the 12-well plate, suck up the medium with a pipette gun, add 2ml PBS to each well and rinse twice; add 500 μL of modified trypsin digestion solution, Digest in a constant temperature incubator at 37°C for about 30 seconds; add 2ml of DMEM medium with 10% FBS to stop the digestion, gently pipette several times with a pipette gun to ensure that all the cells are digested, and the rest is exactly the same as in Example 1.

Embodiment 3

[0082] The preparation method of the improved trypsin digestion solution is as follows: accurately weigh 0.5g of EDTA, 1.0g of dextrose, 9.6g of PBS powder, 3.0g of Tris base, 0.15g of 2-ethyl-3-hydroxy-4-pyrone, Dissolve in 900mL of ultrapure water, adjust the pH to 7.6, then add 1g of trypsin, dissolve and dilute to 1L, filter through a 0.2μm membrane, and store at -20°C. The rest are completely consistent with Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of an MC3R gene edited porcine fibroblast line, and belongs to the field of gene edition. The preparation method comprises the following steps: constructinga gene knockout vector of which the nucleotide sequence of sgRNA is shown as SEQ ID NO: 1 and a gene knockout vector of which the nucleotide sequence of sgRNA is shown as SEQ ID NO: 2, establishing aporcine fibroblast line, transfecting the porcine fibroblast line with the gene knockout vector, and performing screening and positive cloning identification to obtain MC3R gene homozygous knockout monoclonal cells. The preparation method of the MC3R gene edited porcine fibroblast line provided by the invention has the advantages of simplicity, quickness, high efficiency and lower cost.

Description

technical field [0001] The invention belongs to the field of gene editing, and in particular relates to a method for preparing a MC3R gene-edited porcine fibroblast cell line. Background technique [0002] my country is a big consumer of pork, which is an important component of today's animal husbandry, and it is widely raised around the world, so the requirements for pork quality will become higher and higher. Traditional breeding methods have slowed down the development of meat quality improvement, which requires us to use new breeding methods to improve meat quality, such as molecular breeding. At the same time, pigs are closely related to humans, and the structure of each organ is very similar. It has made great contributions to the research in the fields of biology and medicine, and is often regarded as an ideal for studying bioreactors, xenotransplantation and human disease models. Model animals. It can be seen that pigs, as agricultural animals and medical models, p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/12C12N5/10C12R1/91
CPCC12N15/85C07K14/723C12N5/0656C12N2800/107C12N2510/00C12N2500/40C12N2509/00Y02P60/87
Inventor 许明曙刘国良翟德滔渠东存
Owner ZHEJIANG QINGLIAN FOOD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com