Kale bowrky33 gene and its application
A gene and gene synthesis technology, applied in the biological field, can solve the problems affecting the commerciality of products and organs, economic losses, etc.
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] The present invention is further described below in conjunction with specific embodiment, but the protection scope of the present invention is not limited to this:
[0028] 1. Obtain the full-length sequence of the kale BoWRKY33 gene:
[0029] The whole-gene amplification primers were designed with NCBI primer design tool, and the CDS sequence of Brassica oleracea in Brassica Database (BRAD, http: / / brassicadb.org) was used as a reference. Take the cDNA of the kale 'Four Seasons thick strip' leaf planted in the cultivation room of Zhejiang University's agricultural life ring as a template (the extraction method of cDNA is a conventional technique, for example, refer to CN 104561025A), design specific primers, use PrimerSTAR high-fidelity enzyme PCR Amplify the BoWRKY33 fragment.
[0030] The primer sequence is: SmaI-BoWRKY33-F:TCTAGACCCGGGATGGCTGCTTCTTCCCTCCT
[0031] BamHI-BoWRKY33-R:AGTGGATCCCGACAAGAACGAATCAAAAAACGA
[0032] PCR amplification reaction system: 2xPrim...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



