Supercharge Your Innovation With Domain-Expert AI Agents!

Kale bowrky33 gene and its application

A gene and gene synthesis technology, applied in the biological field, can solve the problems affecting the commerciality of products and organs, economic losses, etc.

Active Publication Date: 2022-07-19
ZHEJIANG UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Taking Chinese cabbage as an example, black spot disease is an epidemic outbreak in Northeast, Northwest and North China regions of my country, and the incidence rate in severe areas even reaches 100%, causing serious economic losses, and black spot disease of various cabbage vegetables also seriously affects The commerciality of its output and product organs has caused great economic losses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kale bowrky33 gene and its application
  • Kale bowrky33 gene and its application
  • Kale bowrky33 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The present invention is further described below in conjunction with specific embodiment, but the protection scope of the present invention is not limited to this:

[0028] 1. Obtain the full-length sequence of the kale BoWRKY33 gene:

[0029] The whole-gene amplification primers were designed with NCBI primer design tool, and the CDS sequence of Brassica oleracea in Brassica Database (BRAD, http: / / brassicadb.org) was used as a reference. Take the cDNA of the kale 'Four Seasons thick strip' leaf planted in the cultivation room of Zhejiang University's agricultural life ring as a template (the extraction method of cDNA is a conventional technique, for example, refer to CN 104561025A), design specific primers, use PrimerSTAR high-fidelity enzyme PCR Amplify the BoWRKY33 fragment.

[0030] The primer sequence is: SmaI-BoWRKY33-F:TCTAGACCCGGGATGGCTGCTTCTTCCCTCCT

[0031] BamHI-BoWRKY33-R:AGTGGATCCCGACAAGAACGAATCAAAAAACGA

[0032] PCR amplification reaction system: 2xPrim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, in particular to the kale BoWRKY33 gene and its application in resistance to black spot caused by Alternaria brassicicola. Specifically, the present invention discloses a gene BoWRKY33 for improving the resistance of kale to Alternaria brassicae and a protein encoded by the gene, and also discloses a gene overexpression vector 35Spro::BoWRKY33-YFP, a gene silencing VIGS vector BoWRKY33 ‑PTY.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the kale BoWRKY33 gene and its application in resistance to black spot caused by Alternaria brassicicola. Background technique [0002] Brassica vegetables are the vegetables with the largest cultivation area, the highest total output and the largest consumption in China. The production of Brassica vegetables plays an immeasurably important role in the vegetable supply in Asia and other parts of the world. Alternaria Brassica is a kind of necrotrophic fungus, and the black spot disease caused by it is seriously harmful to Brassica crops. Kale, belonging to Brassica genus, is a special vegetable in China. During its production process, it is easily infected by Alternaria Brassica, which affects its yield and the quality and safety of its products. Excavating Kale against Brassica Chain It is of great biological significance and economic value to analyze the resistance genes of gerani...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N1/21C07K14/415A01H5/00A01H6/20C12R1/19
CPCC07K14/415C12N15/8282
Inventor 汪俏梅陶晗陈莉莉王梦雨夏楚楚曾围苗慧莹
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More