Check patentability & draft patents in minutes with Patsnap Eureka AI!

Brassica alboglabra bailey BoWRKY33 gene and application thereof

A gene and kale technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems that affect the commerciality of product organs, economic losses, etc., and achieve the effect of improving resistance and good application prospects

Active Publication Date: 2020-12-04
ZHEJIANG UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Taking Chinese cabbage as an example, black spot disease is an epidemic outbreak in Northeast, Northwest and North China regions of my country, and the incidence rate in severe areas even reaches 100%, causing serious economic losses, and black spot disease of various cabbage vegetables also seriously affects The commerciality of its output and product organs has caused great economic losses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica alboglabra bailey BoWRKY33 gene and application thereof
  • Brassica alboglabra bailey BoWRKY33 gene and application thereof
  • Brassica alboglabra bailey BoWRKY33 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The present invention is further described below in conjunction with specific embodiment, but protection scope of the present invention is not limited thereto:

[0028] 1. Obtain the full-length sequence of the kale BoWRKY33 gene:

[0029] NCBI primer design tool was used to design whole gene amplification primers, taking the CDS sequence of Brassica oleracea in Brassica Database (BRAD, http: / / brassicadb.org) as a reference. Take the leaf cDNA of Chinese kale 'Four Seasons Thick Strips' planted in the cultivation room of Zhejiang University's Agrobiology Center as a template (the extraction method of cDNA is conventional technology, for example, refer to CN 104561025A), design specific primers, and use PrimerSTAR high-fidelity enzyme PCR Amplification of the BoWRKY33 fragment.

[0030] The primer sequence is: SmaI-BoWRKY33-F:TCTAGACCCGGGATGGCTGCTTCTTCCCTCCT

[0031] BamHI-BoWRKY33-R:AGTGGATCCCGACAAGAACGAATCAAAAAACGA

[0032] PCR amplification reaction system: 2xPrime...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to a brassica alboglabra bailey BoWRKY33 gene and an application thereof to resistance to black spot caused by Alternaria brassicae. Specifically, the invention discloses the gene BoWRKY33 for improving the resistance of brassica alboglabra bailey to alternaria alternata and a protein coded by the gene, and further discloses agene overexpression vector 35SPro: BoWRKY33-YFP and a gene silencing VIGS vector BoWRKY33-PTY.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the kale BoWRKY33 gene and its application in resistance to black spot caused by Alternaria brassicicola. Background technique [0002] Brassica vegetables are the vegetables with the largest planting area, the highest total output, and the largest consumption in China. The production of Brassica vegetables plays an inestimable and important role in the supply of vegetables in Asia and other regions of the world. Alternaria brassicae is a necrotrophic fungus, and the black spot disease caused by it is very harmful to Brassicaceae crops. Kale belonging to the Brassica genus Brassica is a special vegetable in China. It is susceptible to infection by Alternaria brassica during its production process, which affects its yield and the quality and safety of its products. Mining Chinese cabbage against Brassica chain It is of great biological significance and economic value to study the res...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N1/21C07K14/415A01H5/00A01H6/20C12R1/19
CPCC07K14/415C12N15/8282
Inventor 汪俏梅陶晗陈莉莉王梦雨夏楚楚曾围苗慧莹
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More