Unlock instant, AI-driven research and patent intelligence for your innovation.

Simultaneous, sequencing-based analysis of proteins, nucleosomes, and cell-free nucleic acids from a single biological sample

A technology for biological samples and proteins, applied in the field of epigenetic analysis, which can solve the problems of limiting the amount of information, difficult to evaluate cell-free DNA samples, etc.

Pending Publication Date: 2021-07-23
蓝星基因组股份有限公司
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a result, it is difficult to assess more than one or two features of a cell-free DNA sample, such as DNA sequence information and / or methylation data, often using separate workflows for each feature that separate the already small number of DNA samples as input, and limits the amount of information that can be obtained about the same starting molecule (for example, if a single starting cfDNA fragment template contains both methylated and hydroxymethylated cytokines)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Simultaneous, sequencing-based analysis of proteins, nucleosomes, and cell-free nucleic acids from a single biological sample
  • Simultaneous, sequencing-based analysis of proteins, nucleosomes, and cell-free nucleic acids from a single biological sample
  • Simultaneous, sequencing-based analysis of proteins, nucleosomes, and cell-free nucleic acids from a single biological sample

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0259] Design of Adapter Sequences and Generation of Adapter Constructs:

[0260] The custom oligonucleotides in Table 1 (obtained from IDT, Integrated DNA Technologies, Coralville, IA) included three subsets: (1) truncated adapter oligonucleotides for hybridization and generation of adapter constructs; (2) Indexing PCR oligonucleotides for amplification of adapter ligated products and indexing into samples; (3) Universal PCR oligonucleotides for reamplification of libraries containing any indexing motif.

[0261] For initial testing, 24 unique indexes were created. Indexes were derived from a set of commercially available indices and were detected as the reverse complement of the sequence in the indexed PCR oligonucleotide primers (index 1_primer = CAAGCAGAAGACGGCATA

[0262] CGAGATGTCGGTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T

[0263] INDEX X_PRIMERS = CAAGCAGAAGACGGCATACGAGATAGGTCACTGTGACTGGA

[0264] GTTCAGACGTGTGCTCTTCCGATC*T; additional index primers were prepared using...

Embodiment 2

[0277] Optimization of library preparation:

[0278] This example describes the optimization of library preparation using truncated adapters prepared as described in Example 1.

[0279] (a) Preparation of template DNA for custom adapter evaluation:

[0280] Template DNA is practically limited, so for the purpose of optimizing and validating truncated adapters, fragmented genomic DNA was considered to provide the best solution for obtaining large quantities of homogeneous DNA templates. For this purpose, the HyperPlus kit (Roche); although the HyperPlus kit is commonly used for combined fragmentation and library preparation (including adapter ligation), this example uses only fragmented fractions.

[0281] Brain and spleen genomic DNA stocks were diluted to 500 ng / 35 μl in buffered Tris-HCl (pH 8.0) solution. Two replicate formulations were prepared per tissue, total 1 μg genomic DNA / per tissue type. For both brain and spleen gDNA, concentrations and reaction volumes were ...

Embodiment 3

[0315] Head-to-head comparison of adapter performance:

[0316] (a) Library quantification:

[0317] Based on the initial evaluation, a head-to-head evaluation of truncations versus standard (Bioo) adapters was performed. For this experiment, 20 ng of fragmented brain gDNA and 20 ng of spleen gDNA were each prepared in duplicate as described above; however, the remaining 80% of the adapter-ligated gDNA products were processed by the 5hmC enrichment protocol. As a comparison, 10 ng of each DNA type for WGS and 5hmC enrichment were prepared using standard protocols (Bioo adapters). All samples were sequenced on the same flow cell for comparative analysis; when reading by 8bp index on Bioo and custom sample index, the index with Hamming distance >2 had to be selected.

[0318] The size distribution of libraries generated with truncated adapters was very close to expected based on the size distribution of fragmented genomic DNA from brain and spleen samples;

[0319] The size d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for the analysis of a biological sample to determine multiple types of information therefrom in a streamlined, combined workflow, where all information is obtained in a sequencing-based analysis. The information includes the presence and concentration of specific plasma proteins in a blood sample; the number, location, and types of histone modifications associated with cell-free DNA obtained from the same sample; the sequence of cfRNA and cfDNA in the cell-free DNA sample; and epigenetic information pertaining to the cell-free DNA, such as hydroxymethylation and methylation profiles, i.e., the distribution of 5-hydroxymethylcytosine (5hmC) and 5-methylcytosine (5mC) residues, respectively. The invention additionally pertains to a classical sequencing-based method for analyzing a biological sample to determine one or more non-classical sequence features of the sample. Compositions, kits, and related methods are also provided, including an embodiment in which truncated sequencing adapters are used in conjunction with barcoded PCR primers.

Description

technical field [0001] The present invention relates generally to epigenetic analysis, and more particularly to a combinatorial workflow approach for obtaining multiple types of information from a single biological sample. The present invention finds application in the fields of genomics, medicine, diagnostics and epigenetics research. [0002] technical background [0003] Obtaining large amounts of information from relatively small biological samples containing trace amounts of analyte presents unique challenges. For example, cell-free DNA (cfDNA) samples typically contain only a few nanograms of DNA per milliliter of plasma. As a result, it is difficult to assess more than one or two features of a cell-free DNA sample, such as DNA sequence information and / or methylation data, often using separate workflows for each feature that separate the already small number of DNA samples as input, and limits the amount of information that can be known about the same starting molecul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6804C12Q1/6806C12N15/10
CPCC12Q1/6806C12Q1/6804C12N15/1065C12Q2525/179C12Q2525/191C12Q2537/159C12Q2537/164C12Q2563/179C12Q2565/531C12Q2561/125
Inventor P.A.阿伦斯多夫D.斯帕塞克C.E.艾莉森S.莱维
Owner 蓝星基因组股份有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com