Mutant of glutamate dehydrogenase gene promoter and its application

A glutamate dehydrogenase and promoter technology, applied in microorganism-based methods, enzymes, oxidoreductases, etc., can solve problems such as increased strain burden, genome instability, etc., to achieve enhanced expression intensity, high application value, Effect of high promoter activity

Active Publication Date: 2022-02-08
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because increasing the copy number will increase the burden of the bacterial strain to a certain extent, it may lead to the instability of the genome of the bacterial strain, and the above defects do not exist in the expression regulation of the gene by the promoter. Therefore, for improving the production efficiency of corynebacterium amino acids, the field Abundant promoter elements need to be developed to moderately enhance the expression of target genes such as gdh to increase amino acid production efficiency in strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant of glutamate dehydrogenase gene promoter and its application
  • Mutant of glutamate dehydrogenase gene promoter and its application
  • Mutant of glutamate dehydrogenase gene promoter and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1. Construction of Corynebacterium glutamicum gdh gene promoter strength characterization plasmid

[0060] In order to characterize the strength of the gdh gene promoter of Corynebacterium glutamicum, the present invention first constructs a characterization vector, on the basis of the pEC-XK99E plasmid backbone, expresses the N-terminal 60 amino acids of the gdh gene, a connecting peptide and red fluorescent protein gene. According to the published genome sequence and gdh gene annotation information of Corynebacterium glutamicum ATCC13032, the primer gdh-F / R was designed, and the gdh gene promoter and N-terminal 180bp DNA fragment were obtained by PCR amplification using the ATCC13032 genome as a template. pEC-XK99E-rfp reported in the literature (Wang Yingchun et al. Screening of endogenous high-efficiency constitutive promoters in Corynebacterium glutamicum based on time-series transcriptome[J]. Chinese Journal of Biotechnology, 2018,34(11):1760~1771) The...

Embodiment 2

[0063] Embodiment 2. Corynebacterium glutamicum gdh gene promoter mutant screening and intensity characterization

[0064] (1) Construction of Corynebacterium glutamicum gdh gene promoter mutant library

[0065] The core region " AATTCT of Corynebacterium glutamicum gdh gene promoter of the present invention TTGTGGTCA TATCTGTGCGACAC TGCCATAAT TGAACGTG" is mutated, and the underlined places are the main sequences of the -35 region and the -10 region of the promoter respectively. The present invention mutates "AATTCT at the corresponding position of the above core region TTGTNNNNA TATCTGTGCGACAC TNNNATAAT TGAACGTG", use gdh-M1 / M2 and gdh-M3 / M4 primers to amplify the two fragments of the plasmid respectively, and use Novizym's one-step recombination kit to clone and connect, collect all the cloned bacteria obtained and extract the plasmids to obtain The gdh gene promoter mutant library.The above library and the wild-type control pEC-XK99E-Pgdh-rfp obtained in Example 1 wer...

Embodiment 3

[0073] Embodiment 3. Corynebacterium glutamicum gdh gene promoter mutant is applied to proline production

[0074] (1) Evaluation of the construction of the basic strain SLCgP2 for proline production

[0075] According to literature reports, the introduction of the G149K mutation of glutamic acid kinase ProB can remove the feedback inhibition of proline, and the introduction of this mutation on the genome of the Corynebacterium glutamicum ATCC13032 strain can produce proline. The present invention introduces the Corynebacterium glutamicum ATCC13032 strain into G149K mutation, the codon was mutated from GGT to AAG, and the SLCgP1 strain was obtained.

[0076] The inventors further applied the P pyc -20 promoter (the nucleotide sequence of its core region is CGGGCCTTGATTGTAAGATAAGACATTTAGTATAATTAG, as shown in SEQ ID NO: 68, and the nucleotide sequence of the promoter is as shown in SEQ ID NO: 69) overexpressing glutamate that relieves feedback inhibition KinaseproB G149K The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutant of a corynebacterium glutamicum glutamate dehydrogenase gene promoter and application thereof. The mutant has improved promoter activity compared with the wild-type promoter. Therefore, it can be used to enhance the expression of the target gene, for example, it can be operably linked with the glutamate dehydrogenase gene, which can enhance the expression intensity of glutamate dehydrogenase, thereby improving the amino acid production efficiency of the recombinant strain, with High application value.

Description

Technical field: [0001] The invention belongs to the field of biotechnology, and in particular relates to a mutant of a glutamate dehydrogenase gene promoter and an application thereof. Background technique: [0002] Amino acids, including glutamic acid, lysine, proline, etc. are the basic substances that constitute protein required for animal nutrition, and are widely used in industries such as medicine, health, food, animal feed, and cosmetics, and are mainly produced by microbial fermentation. Production. At present, the main production strains include microorganisms of the genus Enterobacter, Corynebacterium, etc., and due to the physiological superiority of Corynebacterium, Corynebacterium has become the most important production strain in the industry. With the continuous development of biotechnology, reports on metabolic engineering of corynebacterium to improve its amino acid production have gradually increased. These modifications include enhancing the expression o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/77C12N1/21C12P13/04C12R1/15
CPCC12N9/0016C12Y104/01002C12N15/77C12P13/04C12R2001/15C12P13/24C40B40/06
Inventor孙际宾刘娇郑平周文娟马延和
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI