Unlock instant, AI-driven research and patent intelligence for your innovation.

Human originating promoter for human body cell to express exogenous gene efficiently

A technology of promoters and genes, applied in the field of human-derived promoters

Inactive Publication Date: 2004-03-31
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recently, it was found that in the commercialized bacterial tet-on vector system for the efficient and controllable expression of eukaryotic genes in vitro, under its optimal induction conditions, the gene expression efficiency is only 3.9% of the gene expression level mediated by the hsp90β regulatory fragment times

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human originating promoter for human body cell to express exogenous gene efficiently
  • Human originating promoter for human body cell to express exogenous gene efficiently
  • Human originating promoter for human body cell to express exogenous gene efficiently

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Construction of reporter gene plasmid pHSP90β6.1 containing promoter B6.1

[0024] 1. Construction of plasmid pHSP90β1 containing hsp90β gene 5' upstream fragment (-1102 / +67bp)

[0025] 1.1 Amplification of the 5' upstream fragment (-1102 / +67bp) of the hsp90β gene:

[0026] According to the sequence of the human hsp90β gene published in the literature ( figure 1 ), designed and synthesized a pair that can amplify hsp90β gene core promoter, upstream promoter element, cAMP response element, an atypical heat shock element (HSE, -648 / -734) and part of the first exon fragment Primers P1 and P2, the primer sequences are as follows:

[0027] P1: 5'GC -1102 GAGCTC CGGCTGCCCTGCAC -1083 3' (the underline is the SacI site)

[0028] P2: 5'GC GAATTC +46 GCAACGTAGGCTTGCTTTCCGA +67 3' (underlined is the EcoRI site) using this pair of primers, a DNA fragment of 1.1 kb consistent with expectations was amplified by PCR from the DNA of the human peripheral blood leuko...

Embodiment 2

[0042] Example 2 Determination of B6.1 promoter activity and its comparison with other viral promoter activities

[0043] A. method

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a humanized promotor for human body cell to high-effectively express exogenous gene. In the concrete the invented promotor is from human thermal shock protein gene hsp 90 beta.

Description

technical field [0001] The invention relates to a human-derived promoter for highly expressing exogenous genes in human cells. Specifically, the promoter of the present invention is from the human heat shock protein gene hsp90β, and the promoter described herein is called B6.1. Background technique [0002] Since the second half of the 20th century, the human disease spectrum has undergone great changes. With the progress of molecular biology research and the expansion and maturity of genetic engineering technology, the nature of diseases is constantly revealed, new single-gene diseases and many diseases that seriously endanger human health, such as tumors, arteriosclerosis, hypertension, asthma, etc. Altered genetic properties or genetic mutations with polygenic involvement. Therefore, the use of genetic engineering products or direct gene therapy has become a necessary means to treat human diseases. At present, the expression systems of Escherichia coli, yeast and insec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/67
Inventor 沈珝琲刘巨洪王晓哲程小款
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More