MERS freeze-drying tube for detecting Middle East Respiratory Syndrome Virus, preparation method of MERS freeze-drying tube and freeze-drying kit

A technology for respiratory syndrome and kits, which is applied in the direction of microbial-based methods, biochemical equipment and methods, and microbial measurement/testing, which can solve problems affecting reagent performance and achieve the effect of ensuring transportation and storage

Inactive Publication Date: 2022-07-29
苏州易科新创科学仪器有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the existing kits for the detection of MERS-CoV, including the above-mentioned patented technology, are all in the form of liquid storage. When used, they need to be frozen and thawed repeatedly, which will affect the performance of the reagents, and they need to be stored at -20°C. Protective measures such as dry ice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MERS freeze-drying tube for detecting Middle East Respiratory Syndrome Virus, preparation method of MERS freeze-drying tube and freeze-drying kit
  • MERS freeze-drying tube for detecting Middle East Respiratory Syndrome Virus, preparation method of MERS freeze-drying tube and freeze-drying kit
  • MERS freeze-drying tube for detecting Middle East Respiratory Syndrome Virus, preparation method of MERS freeze-drying tube and freeze-drying kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] This example provides a freeze-dried kit for detecting MERS virus, the kit includes MERS freeze-dried tubes (8×3 tubes), 1 tube of MERS positive control and 1 mL / tube of negative control, the MERS Lyophilized tube includes Taq enzyme, M-MLV reverse transcriptase, RNase inhibitor, Buffer, primer probe mix, dNTP, MgCl 2 and lyoprotectant.

[0044] in,

[0045] The lyoprotectant includes 3% trehalose, 3% mannitol, 2% BSA, 1% lactose, 0.1% tween80.

[0046] Taking the orf1ab gene as the target gene, a set of specific primers and probes were designed and screened, and BLAST software was used for comparison. The sequence corresponding to the syndrome coronavirus is consistent, and there is no obvious crossover with other virus sequences. Specifically, the primer-probe mixture includes a forward primer, a reverse primer and an oligonucleotide probe, and their sequences are:

[0047] Forward primer sequence: TTAGAGACTCCCTGCCGCTGTA

[0048] Reverse primer sequence: GAATCTTT...

Embodiment 2

[0077] This example provides a freeze-dried kit for detecting MERS virus, the kit includes MERS freeze-dried tubes (8×3 tubes), 1 tube of MERS positive control and 1 mL / tube of negative control, the MERS Lyophilized tube includes Taq enzyme, M-MLV reverse transcriptase, RNase inhibitor, Buffer, primer probe mix, dNTP, MgCl 2 and lyoprotectant.

[0078] in,

[0079] The lyoprotectant includes 6% trehalose, 1% mannitol, 1% BSA, 3% lactose, 0.2% tween80.

[0080] Taking the orf1ab gene as the target gene, a set of specific primers and probes were designed and screened, and BLAST software was used for comparison. The sequence corresponding to the syndrome coronavirus is consistent, and there is no obvious crossover with other virus sequences. Specifically, the primer-probe mixture includes a forward primer, a reverse primer and an oligonucleotide probe, and their sequences are:

[0081] Forward primer sequence: TTAGAGACTCCCTGCCGCTGTA

[0082] Reverse primer sequence: GAATCTTT...

Embodiment 3

[0098] This example provides a freeze-dried kit for detecting MERS virus, the kit includes MERS freeze-dried tubes (8×3 tubes), 1 tube of MERS positive control and 1 mL / tube of negative control, the MERS Lyophilized tube includes Taq enzyme, M-MLV reverse transcriptase, RNase inhibitor, Buffer, primer probe mix, dNTP, MgCl 2 and lyoprotectant.

[0099] in,

[0100] The lyoprotectant includes 8% trehalose, 5% mannitol, 0.1% BSA, 2% lactose, 0.05% tween80.

[0101] Taking the orf1ab gene as the target gene, a set of specific primers and probes were designed and screened, and BLAST software was used for comparison. The sequence corresponding to the syndrome coronavirus is consistent, and there is no obvious crossover with other virus sequences. Specifically, the primer-probe mixture includes a forward primer, a reverse primer and an oligonucleotide probe, and their sequences are:

[0102] Forward primer sequence: TTAGAGACTCCCTGCCGCTGTA

[0103] Reverse primer sequence: GAATC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses an MERS freeze-drying tube for detecting Middle East Respiratory Syndrome Virus, a preparation method of the MERS freeze-drying tube and a freeze-drying kit. The freeze-drying kit for detecting the Middle East Respiratory Syndrome Virus (MERS) comprises an MERS freeze-drying tube, an MERS positive control and an MERS negative control, and the MERS freeze-drying tube comprises Taq enzyme, M-MLV reverse transcriptase, an RNA enzyme inhibitor, Buffer, a primer probe mixture, dNTP, MgCl2 and a freeze-drying protective additive; the freeze-drying protective agent comprises the following components in percentage by weight: 3%-8% of trehalose, 1%-5% of mannitol, 0.1%-2% of BSA (Bovine Serum Albumin), 1%-3% of lactose and 0.05%-0.2% of tween80. The MERS positive control comprises a plasmid with a target gene. The enzyme, the buffer, the primer probe, the dNTP, the freeze-drying protective agent and the like are fully premixed to form a freeze-drying reaction system to form the freeze-drying kit, and the freeze-drying kit can be stably stored at 4-25 DEG C. Therefore, the Middle East Respiratory Syndrome Coronavirus in the sample can be rapidly, efficiently and qualitatively detected, the reaction is totally closed, and only one sample adding operation is performed; the invention relates to a freeze-drying kit which can be stored and transported at normal temperature.

Description

technical field [0001] The invention relates to the field of Middle East Respiratory Syndrome detection, in particular to a MERS freeze-drying tube for detecting Middle East Respiratory Syndrome virus, a preparation method and a freeze-drying kit. Background technique [0002] Middle East Respiratory Syndrome (MERS) is a respiratory infectious disease caused by viral pneumonia caused by coronavirus. It was first discovered in Saudi Arabia in 2012. Its symptoms are similar to SARS, and the recent epidemic of new coronavirus pneumonia. Because it occurred in the Middle East, it is called MERS, and MERS is abbreviated as MERS. Symptoms are similar to SARS and new coronary pneumonia, mainly fever, sore throat, fatigue, and cough. In severe cases, breathing difficulties, respiratory distress, and even respiratory failure can occur. In severe cases, it can be life-threatening or cause multiple organs. damage. Compared with SARS, the epidemic intensity is weaker, but it is also a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/701C12Q1/686C12Q2521/101C12Q2521/107C12Q2527/127C12Q2527/125C12Q2563/107
Inventor 朱海
Owner 苏州易科新创科学仪器有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap