Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Therapy and diagnosis of conditions related to telomere length and/or telomerase activity

a technology of telomerase activity and telomere length, applied in the direction of enzymology, drug composition, fused cells, etc., can solve the problems of unfavorable drug development, unfavorable drug development, and inability to rule out any of these mechanisms, so as to reduce the effect of reducing the cost of treating an individual and reducing the chance of drug becoming

Inactive Publication Date: 2006-08-03
BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0051] This invention concerns methods for therapy and diagnosis of cellular senescence and immortalization utilizing techniques associated with control of telomere length and telomerase activity. Therapeutic strategies of this invention include reducing the rate or absolute amount of telomere repeat length loss or increasing the telomere repeat length during cell proliferation, thereby providing for the postponement of cellular senescence and reducing the level of chromosomal fusions and other chromosomal aberrations. In addition, inhibition of telomerase activity in vivo or in vitro may be used to control diseases associated with cell immortality, such as neoplasia, and pathogenic parasites.

Problems solved by technology

However, the wide variability in doubling potentials, especially in mitotic pairs, suggests an unequalled partitioning of damage or errors at division.”
If loss of telomeric DNA ultimately causes cell-cycle arrest in normal cells, the final steps in this process may be blocked in immortalized cells.
But the absence of detailed information about the mode of replication or degree of recombination at telomeres means that none of these mechanisms can be ruled out.
In any event, it is clear that the maintenance of telomeres is impaired in somatic cells.
However, mutations or epigenetic changes that affect the activity of the telomerase, like any other genetic change, might affect the life span of the individual in which they occur.
He states: “However, such a mechanism is not easily reconciled with the dominance of senescent HDF over young HDF in fusion hybrids, particularly in short-term heterokaryons.
If so, incomplete end replication would be expected to result in the progressive loss of terminal repeats as somatic cells undergo successive rounds of division.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
  • Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
  • Therapy and diagnosis of conditions related to telomere length and/or telomerase activity

Examples

Experimental program
Comparison scheme
Effect test

example 1

Telomere Length and Cell Proliferation

[0178] The effects of telomere length modulation on cellular proliferation were studied. An average of 50 bp are lost per cell division in somatic cells. The telomere end is thought to have a single-stranded region as follows (although the amount of overhang is unknown):

(Seq. ID No. 1)5′TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGCGTTAGGGTTAG GGTTA GGG3′AATCCCAATCCC

[0179] Applicant postulated that loss of this single-stranded overhang should be significantly slowed if cells were provided with a synthetic oligonucleotide of the sequence CCCTAACCCTAA (SEQ ID NO. 2). This oligonucleotide should hybridize to the exposed single-stranded region, and serve as a primer for DNA synthesis by the normal DNA polymerase present in somatic cells. In this way, rather than shortening by an average of 50 bp per division, the telomeres may only shorten by a lesser amount per division, thus significantly extending the number of divisions required before telomere sh...

example 2

Inhibition of Telomerase in Cancer Cells

[0182] One way by which cancer cells are able to escape cellular senescence is by regaining telomerase activity, which permits them to maintain the length of their telomeres in the face of multiple rounds of cell division. The enzyme telomerase contains an RNA complementary to TTAGGG, which allows it to recognize the telomeres and extend them by the addition of additional TTAGGG repeats. In fact, one assay for telomerase uses a TTAGGGTTAGGG (SEQ ID NO: 3) primer and measures the ability of cell extracts to synthesis a ladder of 6 bp additions to this substrate. Telomerase activity in cancer cells is likely to be present in limiting amounts since telomere length is relatively stable (thus only about 50 bp per telomere are added, so that lengthening and shortening are balanced).

[0183] Applicant hypothesized that feeding cells a synthetic TTAGGGTTAGGG oligonucleotide (Seq. ID No. 3) should competitively inhibit the ability of telomerase to elon...

example 3

Telomere Length as a Biomarker

[0185] In the U.S. and Western Europe, atherosclerosis is the principal contributor to mortality from cardiovascular diseases (Ross, 314 N. Engl. J. Med. 488, 1986). Atherosclerosis is characterized by the mural and focal formation of lipid and cell-rich lesions or “plaques” on the intimal surfaces of arterial tissues. This is followed by an age-dependent expansion of the lesion into the lumen, potentially leading to occlusion and to myocardial and / or cerebral infarction (Haust, (1981) in Vascular Injury and Atherosclerosis, ed. Moore, S. (Marcel Dekker Inc., New York), pp. 1-22; Ross and Glomset, 295(7) N. Engl. J. Med. 369, 1976; and Ross, 295(8) N. Engl. J. Med. 420, 1976). Prominent among the mechanisms proposed to explain the pathogenesis of atherosclerosis is the “response-to-injury” hypothesis (Ross, 314 N. Engl. J. Med. 488, 1986; Moore, (1981) in Vascular Injury and Atherosclerosis, ed. Moore, S. (Marcel Dekker Inc., New York), pp. 131-148; an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
total volumeaaaaaaaaaa
temperatureaaaaaaaaaa
timeaaaaaaaaaa
Login to View More

Abstract

Method and compositions are provided for the determination of telomere length and telomerase activity, as well as the ability to inhibit telomerase activity in the treatment of proliferative diseases. Particularly, primers are elongated under conditions which minimize interference from other genomic sequences, so as to obtain accurate determinations of telomeric length or telomerase activity. In addition, compositions are provided for intracellular inhibition of telomerase activity and means are shown for slowing the loss of telomeric repeats in aging cells.

Description

[0001] This application is a continuation-in-part of Michael D. West et al., entitled “Therapy and diagnosis of conditions related to telomere length and / or telomerase activity, filed Mar. 24, 1993, and assigned U.S. Ser. No. 08 / 038,766, U.S. Pat. No. 5,489,508 which is a continuation-in-part of Michael D. West et al., entitled “Telomerase Activity Modulation and Telomere Diagnosis”, filed May 13, 1992, and assigned U.S. Ser. No. 07 / 882,438, abandoned both (including drawings) hereby incorporated by reference herein. [0002] This invention relates to methods for therapy and diagnosis of cellular senescence and immortalization.BACKGROUND OF THE INVENTION [0003] The following is a general description of art relevant to the present invention. None is admitted to be prior art to the invention. Generally, this art relates to observations relating to cellular senescence, and theories or hypothesis which explain such aging and the mechanisms by which cells escape senescence and immortalize....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K48/00C12Q1/68C12N15/09A61K31/70A61K31/7088A61K31/7105A61K38/00A61K38/43A61K38/45A61K38/55A61K45/00A61K49/00A61P35/00A61P43/00C12N5/00C12N5/16C12N9/12C12N15/10C12N15/113C12Q1/25C12Q1/48C12Q1/70G01N33/573
CPCA61K31/522Y10T436/105831A61K31/7076A61K31/711A61K38/00C12N5/0018C12N5/163C12N9/1241C12N15/10C12N15/113C12N15/1137C12N2501/70C12N2510/04C12Q1/48C12Q1/68C12Q1/6827C12Q1/686C12Q1/6876C12Q1/6886C12Q1/703C12Q2600/136C12Y207/07049G01N2333/91245A61K31/70Y10T436/11Y10T436/10Y10T436/115831Y10S977/773Y10S977/927Y10S977/918Y10S977/801C12Q2600/112C12Q2521/113A61P35/00A61P43/00Y02A50/30
Inventor WEST, MICHAELSHAY, JERRYWRIGHT, WOODRING
Owner BOARD OF RGT THE UNIV OF TEXAS SYST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com