Unlock instant, AI-driven research and patent intelligence for your innovation.

Antigenic compositions and use of same in the targeted delivery of nucleic acids

a technology of compositions and nucleic acids, applied in the field of compositions for nucleic acids delivery, can solve the problems of few promising and difficult to find suitable delivery methods for these molecules in various applications

Active Publication Date: 2014-01-28
KAIMI BIOMEDICINE (CHENGDU) CO LTD
View PDF10 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Despite recent advances in the identification and refinement of nucleic acid therapeutics, finding suitable delivery means for these molecules in various applications has proved challenging.
Moreover, while it is desirable to minimize the dosage of these expensive molecules, by localizing or targeting nucleic acid therapies to tissues / cells of interest, many technologies have been investigated, with few promising results.
Targeted delivery of siRNA into specific cells of interest has been the main obstacle to achieving in vivo gene silencing by RNAi technologies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigenic compositions and use of same in the targeted delivery of nucleic acids
  • Antigenic compositions and use of same in the targeted delivery of nucleic acids
  • Antigenic compositions and use of same in the targeted delivery of nucleic acids

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cloning and Expression of a Chimeric Antigen with a C-Terminal Protamine Tail

[0106]Step 1. Cloning—

[0107]DNA encoding a target binding domain (TBD) containing a 5′ Not I site and a 3′ Xba I site was produced by PCR using previously generated pFastBacHTa-TBD as template with unique primers that add the respective restriction enzyme sites. The primers used were;

[0108]

(SEQ ID NO: 8)5′ Primer5′ TGTCATTCTGCGGCCGCAAGGCGGCGGGATCCGTGGACAAGAAAATTGTGCCCAGG 3′(SEQ ID NO: 9)3′ Primer5′ CCGGTCTAGATTCAGCCCAGGAGAGTGGGAGAG 3′.

The PCR fragment was isolated, digested with Not I and Xba I and cloned into a Not I / Xba I digested pFastBacHTa-gp64 plasmid.

[0109]For HBV Core protamine tail, the sequence was obtained by PCR of previously produced plasmid pFastBacHTa HBV Core-TBD as template using primers that add a unique Xba I site to the 5′ end and a unique Hind III site to the 3′ end. The primers used were:

[0110]

(SEQ ID NO: 10)5′ Primer:5′ CCGGTCTAGAGGAAACTACTGTTGTTAGACGAC 3′and(SEQ ID NO: 11)3′ Primer:5...

example 2

Visualization of Chimigen Aggregation

[0120]Chimigen® HBV Core Vaccine and Chimigen® HBV S1 / S2 Core Vaccine were visualized using Tapping Mode Atomic Force Microscopy (TM-AFM). The images generated are shown in FIG. 6a-d and 7a-d, respectively. As indicated, the aggregates / nanoparticles formed are of uniform size and ellipsoid shape, having a diameter of 30-40 nm and a height of 2 nm.

example 3

Encapsulation of shRNA Plasmid by Chimigen® S1 / S2 Core Vaccine

[0121]SureSilencing shRNA plasmid was mixed with Chimigen HBV S1 / S2 Core Vaccine under denaturing conditions. After removal of the denaturing conditions, encapsulation was evaluated by DNase treatment and PCR amplification of GFP DNA. The shRNA vector plasmid and results are shown in FIGS. 8a and 8b, respectively. It is noted that both vaccines protected the GFP DNA from DNAse treatment, suggesting that the vaccines are capable of forming encapsulated delivery vehicles around nucleic acids.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
heightaaaaaaaaaa
diameteraaaaaaaaaa
nucleic acid interactionaaaaaaaaaa
Login to View More

Abstract

Methods and compositions are provided for delivery of therapeutic nucleic acids to a target cell. A chimeric antigen is provided to encapsulate, bind, or otherwise carry a nucleic acid molecule to a target cell where the chimeric antigen and nucleic acid are internalized by receptor-mediated endocytosis. The chimeric antigen has a nucleic acid interaction domain, a target binding domain, and an immune response domain that may include a target antigen. Targeting is generally provided by the specificity of the target binding domain for a particular target cell receptor, but may also be provided by inclusion of a targeting antigen within the immune response domain. The combined delivery of chimeric antigen and nucleic acid, which may be a siRNA, may be synergistic in certain applications, for example in breaking host tolerance to a virus or in providing immunostimulation.

Description

FIELD OF THE INVENTION[0001]The present invention relates to compositions for use in the delivery of nucleic acids. More particularly, chimeric antigens are provided for encapsulating, binding, or otherwise carrying and delivering nucleic acids to a target cell.BACKGROUND OF THE INVENTION[0002]Despite recent advances in the identification and refinement of nucleic acid therapeutics, finding suitable delivery means for these molecules in various applications has proved challenging. Moreover, while it is desirable to minimize the dosage of these expensive molecules, by localizing or targeting nucleic acid therapies to tissues / cells of interest, many technologies have been investigated, with few promising results.[0003]RNAi [Fire A., et al (1998) Nature 391:801-11] has emerged as a means for sequence specific, posT transcriptional gene silencing, mediated by short interfering RNAs (siRNAs) homologous to the gene targeted for silencing. However, to be effectively used as drugs, the siRN...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(United States)
IPC IPC(8): C12N15/87A61K48/00C12N15/11A61K39/00
CPCC12N2320/32C07K2319/85C12N15/62A61K47/4833C12N15/87C07K2319/74A61K48/00C12N2310/14A61K2039/64C07K2319/80A61K2039/6056C12N2730/10134C12N15/111A61K39/292C12N2810/859A61K2039/6075C12N2730/10122C07K2319/035A61K2039/6025A61K48/0025C07K2319/33C07K2319/21C07K16/28C07K2319/30C07K14/005A61K39/12A61K2039/5154A61K2039/6006A61K2039/625A61K47/646A61P31/12A61P33/00A61P35/00A61P37/04A61P37/06
Inventor GEORGE, RAJANNOUJAIM, ANTOINE
Owner KAIMI BIOMEDICINE (CHENGDU) CO LTD