A promoter from Fusarium venetianus and a visual gene knockout screening method

A fusarium and promoter technology, applied in the field of genetic engineering, can solve the problems of laborious and laborious, low homologous recombination rate, etc., and achieve the effect of improving screening efficiency and efficient screening

CN114410634BActive Publication Date: 2022-06-24TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Publication Date
2022-06-24

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a high-efficiency endogenous strong promoter derived from Fusarium veniceum, and a screening method for visual gene knockout transformants suitable for Fusarium venetianum. Using this method, if the target gene fragment is randomly inserted into the genome of Fusarium venezia, the colony will show fluorescence; if the target fragment achieves homologous knockout of the target gene, the colony will not emit fluorescence. Therefore, the vast majority of randomly inserted transformants (with fluorescence) can be easily excluded, and the transformants without fluorescence can be verified by PCR specificity. The results show that the screening efficiency of knockout transformants can be significantly improved. The screening system provided by the invention realizes convenient, rapid and efficient screening to knockout transformants from strains with low homologous recombination rate.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to the field of genetic engineering, in particular to a promoter derived from Fusarium venetianus and a method for a visual gene knockout screening system. Background technique

[0002] Fusarium venezia is an industrial strain screened from more than 3,000 fungi that can be used for fermentative production of mycelin. Compared with the single-cell protein, the mycelial protein produced by the fermentation of this strain is more delicious, has a meat-like tissue structure, and can provide a good nutritional balance, including low fat content, complete amino acid types, rich in trace elements, vitamins and benefits. Edible crude fiber for human gastrointestinal motility. In addition, Fusarium venezia mycelial protein also has very good safety, and has obtained the marketing license of food raw materials in 18 countries around the world. Therefore, it has the potential to partially or completely replace animal-based and plant-based...

Examples

Embodiment 1

[0044] Example 1 Construction of a high-efficiency Fusarium venetianus TB01 endogenous promoter regulated GFP gene expression vector

[0045] Through investigation and analysis, referring to the situation of promoters in other species, the endogenous promoters PgpdA, Pgla and Ptef of Fusarium venezia TB01 were studied and explored to screen out the strong endogenous promoters. The specific process is as follows:

[0046] The sequences of the endogenous promoters PgpdA (FVRRES_09878), Pgla (FVRRES_01380) and Ptef (FVRRES_13282) were amplified from the DNA genome of Fusarium venezia TB01 with primer pairs PgpdA1 / 2, Pgla1 / 2 and Ptef1 / 2, respectively. Pgfp-T1 / 2 amplified the GFP-Ttrpc sequence from the vector pK2-Ptrpc-GFP-Ttrpc. Subsequently, it was connected to the resistance backbone vector pK2-neo by homologous recombinase to obtain the corresponding endogenous promoter-regulated GFP gene expression vector. After transforming it into E. coli DH5α, a single colony was selecte...

Embodiment 2

[0053] Example 2 Protoplast transformation of Fusarium venezia TB01 with different promoters regulating GFP gene expression cassette

[0054] 1. Culture medium

[0055] YEPD: yeast powder 3g, peptone 10g, glucose 20g, make up to 1L; buffer for dissolving enzyme: 0.7 M sodium chloride; STC: 0.8 M sorbitol; 50 mM CaCl 2 , 50 mM Tris-HCl (Ph 8.0); SPTC: STC containing 40% PEG6000; regeneration medium: yeast extract 1g, tryptone 1g, sucrose 274g, agarose 10g, constant volume 1L; screening medium: glucose 30g , Yeast powder 6g, agar powder 15g, dilute to 1L.

[0056] 2. Primers

[0057] PpKLB1:GGTGGCAGGATATATTGTGG (SEQ ID NO. 8);

[0058] PpKLB2: TTGGTTGGTCAAGTCCTGGT (SEQ ID NO. 9).

[0059] 3. Fragment Amplification Procedure

[0060] 98℃ 10s, 55℃ 15s, 72℃ 3mins; 35 cycles (primestar, TaKaRa)

[0061] 4. Experimental method

[0062] 1) Amplification of transformed fragments

[0063] The fragment PgpdA::GFP-neo was amplified from pK2-Promoter::GFP-neo by designing the prime...

Embodiment 3

[0077] Example 3 Construction of a visual gene knockout transformant screening vector

[0078] The left and right arm sequences of the chitin synthase gene knockout region were amplified from the DNA genome of Fusarium venezia TB01 with primer pairs a few left arm 1 / 2 and a few right arm 1 / 2, respectively, and sequenced by seamless cloning Linked to both sides of the resistance gene expression cassette of the vector pK2-neo; then knocked out 1 / 2 of the cassette from the constructed pK2-Chs with primer pairs upstream -neo-Chs downstream Chs amplified in the vector upstream -neo-Chs downstream fragment, and ligated it into the backbone vector pK2-PgpdA::GFP by homologous recombinase (US Everbright) to obtain pK2-PgpdA::GFP-Chs upstream -neo-Chs downstream , after transformation of E. coli DH5α, a single colony was selected for Pme I and Xba I double-enzyme digestion verification, select the correct transformants.

[0079] Table 3 Construction of visual gene knockout tran...