Monoclonal antibody of membrane protein E for resisting West Nile virus and application thereof

A monoclonal antibody, West Nile virus technology, applied in antiviral immunoglobulin, biochemical equipment and methods, instruments, etc.

Inactive Publication Date: 2008-08-06
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI +1
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Foreign scholars used inactivated WNV, DNA vaccine and the extracellular region of WNV E protein as antigens to imm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monoclonal antibody of membrane protein E for resisting West Nile virus and application thereof
  • Monoclonal antibody of membrane protein E for resisting West Nile virus and application thereof
  • Monoclonal antibody of membrane protein E for resisting West Nile virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1. Obtaining of Monoclonal Antibody WNV-2F5' or WNV-4B3'

[0026] The murine hybridoma cell line WNV-2F5 or WNV-4B3 capable of secreting the monoclonal antibody WNV-2F5' or WNV-4B3' was prepared by the inventors according to the following method: 1) express West Nile virus in vitro using the Escherichia coli expression system The third domain protein of membrane protein E is purified to obtain recombinant EDIII protein, and the recombinant protein is refolded to refold the protein; 2) the recombinant protein is used as an antigen to immunize mice to prepare fused hybridoma cells. Cells secreting monoclonal antibodies against West Nile virus were obtained by limiting dilution.

[0027] The specific experimental methods and experimental results are as follows:

[0028] 1. Recombinant expression and renaturation of WNV membrane protein EDIII

[0029] 1. Construction of prokaryotic expression vector pET-EDIII

[0030] In order to express the WNV EDIII recombinant...

Embodiment 2

[0038] Example 2. Indirect ELISA detection of binding of purified antibody to coated antigen EDIII

[0039] With the recombinant WNV EDIII protein purified in Example 1 (dissolve 1 μg of recombinant EDIII protein in 5ml of pH9.6 carbonate buffer) to coat the microtiter plate, 20ng / hole, overnight at 4°C, use the same concentration of bovine Serum albumin (BSA) coated, as a negative control. Block with PBS solution containing 3% BSA at 37°C for 1 hour, wash with PBST solution (PBS containing 0.05% (volume percentage) Tween 20) for 4 times, and add serial dilutions with a concentration of 0.002-200 μg / ml Purified antibody, 100 μl / well, incubated at 37°C for 1 hour. After washing with PBST for 4 times, HRP-labeled anti-mouse secondary antibody (1:2000 dilution, Santa Cruz, Inc.) was added, 100 μl / well, and incubated at 37°C for 40 minutes. After washing 4 times with PBST, add a mixture of TMB (tetramethylbenzidine) and hydrogen peroxide (mixed in a volume ratio of 1:1) for colo...

Embodiment 3

[0044] Embodiment 3, immunoblotting method detects the specific reaction of antibody and denatured antigen

[0045] 1. Construction of WNV E protein expression vector pcDNA-WNV E

[0046] In order to express WNV E recombinant protein in eukaryotic cells, the following primers were designed and synthesized: P1: GGGGTACCACCATGTTCAACTGCCTTGG (Sequence 2), P2: CCGCTCGAGCGCATGCACGTTCAC (Sequence 3).

[0047] WNV virus preserved at -80°C (Bird 5810 strain, Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, references are Davis CT, Li L, May FJ, Bueno R Jr, Dennett JA, Bala AA, GuzmanH, Quiroga-Elizondo D , Tesh RB, Barrett AD. Genetic stasis of dominant West Nilevirus genotype, Houston, Texas. Emerg Infect Dis. 2007, 13 (4): 601-4.), by extracting viral RNA (QIAmp Viral RNA Mini Kit, CAT.No .52904), and then reverse transcription (TaKaRa RNA PCRKit (AMV) Ver.3.0, Code No.DRRO19A) to obtain viral cDNA, using the following PCR system (25 μl) to amplify ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses two monoclonal antibodies west nile virus and an relative application, wherein the monoclonal antibody is secreted from mice hybridoma cell WNV-2F5 of preservation number CGMCC No.2261 and mice hybridoma cell WNV-4B3 of preservation number CGMCC No.2262. The antigenic determinant of the monoclonal antibody is the third structural field of membrane protein E on west nile virus envelope. The monoclonal antibody is selected by indirect enzyme linked immunity method, analyzed by western blot, detected by flow cytometry, analyzed by surface plasma resonance and indirect immunity fluorescence method to completely analyze the specificity and affinity of combination with antigen, the antibody is marked by bioepiderm to build an antigen trap indirect enzyme linked immunity detection system. The inventive monoclonal antibody can be applied in various west nile virus antigen and in the test agent box preparation of west nile virus.

Description

technical field [0001] The invention relates to a monoclonal antibody against the membrane protein E of West Nile virus and its application. Background technique [0002] West Nile virus (WNV) infection can cause West Nile fever, West Nile virus encephalitis and meningitis, and is a zoonotic, natural foci, acute infectious disease. Since WNV broke out in New York, USA in 1999, the virus has spread rapidly to many countries and regions in the world, becoming a viral disease that seriously threatens human health, and has attracted the attention of the global public health community. WNV can infect a variety of mosquitoes and birds, and spread the virus along the migration path of birds through the alternate infection of mosquitoes and birds; mosquitoes can also transmit WNV to a variety of mammals by biting WNV-infected birds , such as humans, horses, dogs, cats and poultry such as chickens, geese, etc.; the virus can also be transmitted vertically through blood transfusion, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/10C12N5/18G01N33/577
Inventor高福田克恭刘俊娥曹振
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI